Recombinant Modified Vaccinia Virus Ankara Generating Ebola Virus-Like Particles

Products Related to West Nile, Dengue, Malaria, T.B, Chikungunya, Sars, Zika

Product# 12003 Ebola Recombinant Gycoprotein, GP1 Full Length, amino acids, 60 to 495 (E.Coli)

Product# 12002 Ebola Recombinant Fusion Glycoprotein GP2 Antigen (E.Coli)

 

ABSTRACT

There are currently no approved therapeutics or vaccines to treat or protect against the severe hemorrhagic fever and death caused by Ebola virus (EBOV). Ebola virus-like particles (EBOV VLPs) consisting of the matrix protein VP40, the glycoprotein (GP), and the nucleoprotein (NP) are highly immunogenic and protective in nonhuman primates against Ebola virus disease (EVD). We have constructed a modified vaccinia virus Ankara-Bavarian Nordic (MVA-BN) recombinant coexpressing VP40 and GP of EBOV Mayinga and the NP of Taï Forest virus (TAFV) (MVA-BN-EBOV-VLP) to launch noninfectious EBOV VLPs as a second vaccine modality in the MVA-BN-EBOV-VLP-vaccinated organism. Human cells infected with either MVA-BN-EBOV-VLP or MVA-BN-EBOV-GP showed comparable GP expression levels and transport of complex N-glycosylated GP to the cell surface. Human cells infected with MVA-BN-EBOV-VLP produced large amounts of EBOV VLPs that were decorated with GP spikes but excluded the poxviral membrane protein B5, thus resembling authentic EBOV particles. The heterologous TAFV NP enhanced EBOV VP40-driven VLP formation with efficiency similar to that of the homologous EBOV NP in a transient-expression assay, and both NPs were incorporated into EBOV VLPs. EBOV GP-specific CD8 T cell responses were comparable between MVA-BN-EBOV-VLP- and MVA-BN-EBOV-GP-immunized mice. The levels of EBOV GP-specific neutralizing and binding antibodies, as well as GP-specific IgG1/IgG2a ratios induced by the two constructs, in mice were also similar, raising the question whether the quality rather than the quantity of the GP-specific antibody response might be altered by an EBOV VLP-generating MVA recombinant.

IMPORTANCE The recent outbreak of Ebola virus (EBOV), claiming more than 11,000 lives, has underscored the need to advance the development of safe and effective filovirus vaccines. Virus-like particles (VLPs), as well as recombinant viral vectors, have proved to be promising vaccine candidates. Modified vaccinia virus Ankara-Bavarian Nordic (MVA-BN) is a safe and immunogenic vaccine vector with a large capacity to accommodate multiple foreign genes. In this study, we combined the advantages of VLPs and the MVA platform by generating a recombinant MVA-BN-EBOV-VLP that would produce noninfectious EBOV VLPs in the vaccinated individual. Our results show that human cells infected with MVA-BN-EBOV-VLP indeed formed and released EBOV VLPs, thus producing a highly authentic immunogen. MVA-BN-EBOV-VLP efficiently induced EBOV-specific humoral and cellular immune responses in vaccinated mice. These results are the basis for future advancements, e.g., by including antigens from various filoviral species to develop multivalent VLP-producing MVA-based filovirus vaccines.

KEYWORDS: Ebola, MVA, VLP

INTRODUCTION

Most members of the family Filoviridae, including Ebola viruses and Marburg viruses, cause severe hemorrhagic fevers with high fatality rates in humans and great apes (1, 2). The genus Ebolavirus contains five virus species, including Zaire ebolavirus and Taï Forest ebolavirus. The genomes of the members of these five species differ by more than 30% at the nucleotide level (3). Ebola virus (EBOV) is the type virus of the species Zaire ebolavirus and has been responsible for most of the known outbreaks of Ebola virus disease (EVD) in Africa. The case-fatality rate in Ebola virus outbreaks ranges up to 90%, while only one human case of Taï Forest virus (TAFV) infection that was nonfatal has been reported so far. However, TAFV infection can be lethal for cynomolgus macaques (4). The 2014-2015 epidemic of EVD in West Africa, caused by a regional EBOV variant named Makona, demonstrated that Ebola viruses not only give rise to locally restricted outbreaks, but can also cause large and disastrous epidemics. A total of 28,616 cases, including 11,310 deaths, have been counted during the recent West African Ebola epidemic (5). A number of vaccines against EVD are currently under development, comprising virus-like particles (VLPs), an inactivated genetically modified EBOV, and various viral vectors, which include modified vaccinia virus Ankara-Bavarian Nordic (MVA-BN), human and chimpanzee adenovirus, and vesicular stomatitis virus (VSV) (6,–10).

EBOV VLPs purified from the supernatant of cells expressing EBOV glycoprotein (GP), VP40, and nucleoprotein (NP) have been demonstrated to protect nonhuman primates (NHPs) against lethal challenge with the homologous EBOV (11). The EBOV matrix protein VP40 alone is able to drive the generation of filovirus-like particles with the typical filamentous morphology but lacking the GP surface spikes of bona fide EBOV virions (12,–15). Since EBOV GP is the critical target antigen for the induction of protective immune responses (16, 17), a minimal Ebola VLP vaccine should include GP and VP40. Moreover, GP enhances the efficacy of VP40-driven VLP formation, which can be further stimulated by coexpressing other EBOV proteins, in particular NP, but also VP30 and VP24 (18, 19). Such EBOV VLPs are noninfectious and thus safe, since they lack viral genomic nucleic acid.

MVA-BN is a highly replication-restricted vaccinia virus derived from its replication-competent ancestor, chorioallantois vaccinia virus Ankara, by over 570 passages in chicken embryo cells (20, 21). A large body of preclinical and clinical evidence supports the conclusion that MVA-BN is a safe and immunogenic vaccine, which has paved the way for the approval of MVA-BN as a smallpox vaccine in the European Union and Canada. In addition, numerous MVA recombinants have been shown to efficiently induce immune responses in animals and humans against heterologous antigens (22, 23). Recently, a recombinant MVA-BN expressing EBOV GP, together with other filovirus antigens, was shown in human trials to efficiently enhance humoral and cellular responses directed to EBOV GP if used as a prime or boost vaccination in combination with human or chimpanzee adenoviral vectors (7, 9). This demonstrates the potential of MVA-BN as a vaccine platform to protect against lethal hemorrhagic fevers of humans, like EVD, in combination with a heterologous viral vector.

To mimic the authentic structure of GP, the most relevant EVD vaccine antigen, as accurately as possible, we designed a recombinant MVA-BN vector vaccine generating EBOV VLPs in the vaccinated organism. Such VLPs would provide a second vaccine modality in the vaccinated individual, in addition to the vector-driven cell-restricted expression of EBOV proteins. Here, we describe a recombinant MVA-BN (MVA-BN-EBOV-VLP) that was engineered to express EBOV VP40, along with EBOV GP and TAFV NP, in infected cells. The TAFV version of NP was chosen to provide a broader representation of T cell antigens from different Ebola virus species in the vaccine construct. This recombinant virus directed the release of EBOV VLPs that were densely decorated with EBOV GP on their surfaces into the supernatant of infected cells, demonstrating that EBOV VLP morphogenesis was compatible with the MVA platform. NPs from EBOV and TAFV both enhanced the formation of VLPs driven by EBOV VP40 and were found in VLPs. MVA-BN-EBOV-VLPs efficiently induced GP-specific cellular and humoral immune responses in mice, which were quantitatively comparable to those induced by MVA-BN-EBOV-GP expressing only GP.

Go to:

RESULTS

Recombinant MVA constructs MVA-BN-EBOV-GP and MVA-BN-EBOV-VLP.

The aim of this study was to generate a recombinant MVA-BN vector to protect against EVD that not only expresses the major protective antigen GP, but also triggers the production of EBOV VLPs in infected cells. For this, the genes encoding VP40 and GP, both derived from the Mayinga variant of EBOV, and NP derived from TAFV were inserted into intergenic regions (IGRs) of MVA-BN under the control of the early/late vaccinia virus promoters PrS and PrS5E (Fig. 1A). PrS5E contains the PrS compact synthetic early/late promoter and five additional Pr7.5 early elements (24, 25).

 

 

FIG 1

Cellular expression of Ebola virus GP, VP40, and NP driven by recombinant MVAs. (A) Schematic representation of wild-type MVA (MVA-BN) and MVA recombinants expressing Zaire ebolavirus glycoprotein (EBOV GP) either alone (MVA-EBOV-GP) or in combination with EBOV VP40 and TAFV NP (MVA-BN-EBOV-VLP). Expression cassettes were introduced into the MVA genome at IGRs (indicated by small arrows). The poxviral promoters PrS and PrS5E driving gene transcription of filoviral transgenes are indicated. (B to D) HeLa cells in 12-well plates were infected with the indicated viruses at an MOI of 10. (B) For Western blot analysis, cells were lysed at 6 h and 24 h p.i. in 150 μl of 1× Laemmli sample loading buffer. Cellular lysates prepared at 24 h p.i. were diluted 1:3, as indicated by the asterisks; separated by reducing SDS-PAGE; and transferred to polyvinylidene difluoride (PVDF) membranes. The blots were incubated with anti-GP antibody (MAb 6D8) and subsequently with anti-mouse IgG peroxidase conjugate. The immunoblots were developed with a standard chemiluminescent peroxidase substrate. (C) Analysis of N-glycosylation patterns of EBOV GP. HeLa cells were lysed in 150 μl of 1× RIPA buffer at 17 h p.i. Protein lysates were treated with Endo H or PNGase F or were left untreated (−). Following endoglycosidase treatment, the proteins were mixed with 3× Laemmli loading buffer, separated by reducing SDS-PAGE, and analyzed by immunoblotting using an anti-GP antibody (MAb 6D8). The immunoblot was developed using an ECL detection system with enhanced sensitivity. (D) Flow cytometric analysis of EBOV GP expression. At 4 h and 24 h p.i., HeLa cells were suspended in PBS-2% FCS and incubated with anti-EBOV GP antibody (MAb 6D8) and subsequently with anti-mouse IgG-allophycocyanin. The stained cells were analyzed by flow cytometry, and cell surface expression of EBOV GP is represented in the histogram plots. (E) HEK 293T/17 cells in 12-well plates were incubated for 2 h with the indicated viruses (MOI, 5). Thereafter, the inoculum was replaced with DMEM-2% FCS. One day after infection, adherent cells were lysed in 1× Laemmli loading buffer and analyzed by immunoblotting using antibodies directed to EBOV GP, EBOV VP40, or TAFV NP.

The expression of EBOV GP was studied by Western blotting of cell lysates from HeLa cells infected with MVA-BN-EBOV-GP or MVA-BN-EBOV-VLP. Two distinct bands were observed in lysates of cells infected with either MVA-BN-EBOV-GP or MVA-BN-EBOV-VLP (Fig. 1B). The upper band detected at 6 h and 24 h postinfection (p.i.) (Fig. 1B, lanes 3 to 6) likely represents the mature, fully N- and O-glycosylated GP that had been proteolytically cleaved into the large subunit GP1 and the small subunit GP2. GP2 was not recognized by the antibody used. In addition, the mature GP1 could not be distinguished from the uncleaved and fully glycosylated precursor GP (preGP) due to the very similar migration of these two forms in our SDS-PAGE system. The lower band (Fig. 1B, lanes 3 and 5) was detected at 6 h but not at 24 h p.i. and presumably represents the immature and unprocessed GP precursor protein residing in the endoplasmic reticulum (preGPER) (26, 27). GP1 and the uncleaved precursor preGP have larger apparent molecular weights than preGPER due to extensive O-glycosylation and maturation of the N-glycans from the high-mannose to the complex-type form (27, 28). Lysates of cells infected with MVA-BN-EBOV-GP or MVA-BN-EBOV-VLP revealed very similar patterns of EBOV GP-specific bands, indicating similar GP processing and maturation (Fig. 1B).

To further characterize the two major forms of recombinant EBOV GP, we analyzed N-glycosylation of the protein by using two different endoglycosidases. Endoglycosidase H (Endo H) removes N-glycans of the high-mannose type, which have been cotranslationally attached to the protein in the endoplasmic reticulum (ER). During transport of glycoproteins through the Golgi apparatus, their N-glycans are further processed to the complex type, rendering them resistant to Endo H. Both, ER- and Golgi apparatus-resident N-glycans are sensitive to peptide-N-glycosidase F (PNGase F), which removes high-mannose hybrid, as well as complex, N-glycans. However, O-linked glycans, which are added to EBOV GP in the Golgi apparatus, are not susceptible to either of the two enzymes. HeLa cell lysates prepared 17 h p.i. with MVA-BN-EBOV-GP or MVA-BN-EBOV-VLP were either mock treated or incubated with Endo H or PNGase F and analyzed by immunoblotting (Fig. 1C). The upper band, likely representing GP1/preGP, proved to be resistant to Endo H-mediated deglycosylation, indicating that this GP form had left the ER and entered the Golgi apparatus. In contrast, the faster-migrating band, presumably representing uncleaved preGPER (27, 28), was clearly affected by Endo H digestion, indicating that a proportion of EBOV GP still resided in the ER late in infection (Fig. 1C, lanes 2 and 5). We were not able to distinguish between GP1 and Endo H-resistant preGP in our gel system. Treatment with PNGase F affected the migration of both the upper and lower EBOV GP bands and generated an additional GP species that migrated in the gel as a broad and prominent smear (Fig. 1C, lanes 3 and 6), likely representing the de-N-glycosylated but still O-glycosylated EBOV GP.

Flow cytometric analysis of HeLa cells infected with either MVA-BN-EBOV-GP or MVA-BN-EBOV-VLP showed that EBOV GP was already present at the cell surface in large amounts at 4 h p.i. (Fig. 1D). EBOV GP levels were only slightly increased when the cells were analyzed 24 h p.i. No significant differences in EBOV GP cell surface expression levels were detected between cells infected with MVA-BN-EBOV-GP and cells infected with MVA-BN-EBOV-VLP.

In addition to expression of GP, HEK 293T/17 cells infected with MVA-BN-EBOV-VLP also expressed EBOV VP40 and TAFV NP, as indicated by detection of specific bands in immunoblots at approximately 40 kDa and 100 kDa, respectively (Fig. 1E). In summary, no obvious differences in intracellular and cell surface expression levels and glycosylation of EBOV GP were observed throughout the time course of infection with MVA-BN-EBOV-GP and MVA-BN-EBOV-VLP (Fig. 1B to ​toD).D). These results indicate that neither any MVA-BN factors nor coexpression of VP40 and NP interfered with the transport or N-glycosylation of EBOV GP along the secretory pathway.

Intracellular distribution of Ebola virus proteins in MVA-BN-EBOV-VLP-infected cells.

Confocal laser scanning microscopy was used to examine the synthesis and subcellular localization of EBOV GP, EBOV VP40, and TAFV NP with specific antibodies (Fig. 2). Enhanced green fluorescent protein (EGFP) fluorescence (a selection marker in MVA-BN-EBOV-VLP and MVA wt, shown in gray) and red fluorescent protein (RFP) fluorescence (a selection marker in MVA-BN-EBOV-VLP and MVA-BN-EBOV-GP, shown in gray) were used to identify vector-infected cells. In cells infected with MVA-BN-EBOV-VLP or MVA-BN-EBOV-GP, EBOV GP was mainly located at the cell membrane, where it was present in long cellular protrusions (Fig. 2, left two columns, green). Similar to EBOV GP, the matrix protein EBOV VP40 was strongly associated with the cell membrane (Fig. 2, middle two columns, magenta). TAFV NP formed large aggregates in the cytoplasm that resembled typical inclusion bodies (Fig. 2, right two columns, cyan). In addition to these large NP aggregates, there were smaller aggregations of TAFV NP that were closely associated with the plasma membrane (Fig. 2, top right). Since VP40 is also located mainly at or below the plasma membrane (Fig. 2, top middle), it is very likely that a fraction of VP40 and NP colocalized, though this could not be formally proven due to technical constraints. Taken together, the subcellular localization of the MVA-encoded Ebola virus proteins was consistent with previously published data (29) and further supports and extends our initial observation by confirming that MVA infection does not interfere with the intracellular distribution of GP, VP40, and NP.

FIG 2

Intracellular distribution of EBOV GP, EBOV VP40, and TAFV NP expressed by recombinant MVAs. HeLa cells infected with MVA-BN-EBOV-VLP (expressing EBOV GP, EBOV VP40, and TAFV NP), MVA-BN-EBOV-GP (expressing EBOV GP alone), or wt MVA were fixed and permeabilized 6 h p.i. and incubated with either anti-EBOV GP MAb 6D8 (green), polyclonal rabbit anti-EBOV VP40 antibody (magenta), or polyclonal rabbit anti-TAFV NP antibody (cyan). Antigen-bound primary antibodies were detected with Alexa Fluor-conjugated secondary antibodies, and the cells were analyzed with an inverse confocal laser scanning microscope. MVA vector-infected cells were detected by either EGFP or RFP fluorescence (shown in gray).

Ebola VLPs in supernatants of MVA-BN-EBOV-VLP-infected cells.

We prepared VLPs from supernatants of cells infected with MVA-BN-EBOV-VLP and analyzed these preparations, as well as plain supernatants and cellular lysates, for the presence of EBOV GP, EBOV VP40, and TAFV NP. Infections with MVA-BN-EBOV-GP and MVA-BN wild type (wt) were included as controls (Fig. 3). Levels of GP were slightly higher in lysates of cells infected with MVA-BN-EBOV-GP than in those infected with MVA-BN-EBOV-VLP. EBOV GP was detectable in supernatants and in sucrose cushion-purified supernatants from MVA-BN-EBOV-GP-infected cells, indicative of GP release in the form of pleomorphic particles, as described previously (15, 28). In comparison, GP levels were higher in the supernatants and VLP preparations from cells infected with MVA-BN-EBOV-VLP (Fig. 3). Thus, more GP was released upon coexpression of VP40 and TAFV NP, most likely by formation of EBOV VLPs. VP40 was also present in supernatants and was highly enriched in VLP preparations, indicating the formation of VP40-driven VLPs by MVA-BN-EBOV-VLP-infected cells (Fig. 3). The smaller VP40 forms most likely represent a translation product initiated at the internal methionine residue 14 and degradation products, as previously described (30). TAFV NP was also detectable in VLP preparations, but not in plain supernatants, implying that TAFV NP had been incorporated in a species-independent manner into VLPs, driven by EBOV VP40 expression.

 

FIG 3

Release of MVA-encoded EBOV VLPs and incorporation of TAFV NP. 293T/17 cells in T75 cell culture flasks were infected (MOI, 10) with MVA-BN-EBOV-VLP (expressing EBOV GP, EBOV VP40, and TAFV NP), MVA-BN-EBOV-GP (expressing EBOV GP alone), or MVA-BN wt. After 2 h, the inoculum was replaced with DMEM-5% FCS. One day after infection, supernatants from infected cells were precleared (400 × g for 5 min) and purified by centrifugation through a 20% sucrose cushion at 36,000 rpm in a Beckmann SW41 rotor for 2 h. The adherent cells were scraped in PBS and lysed in 1× Laemmli sample loading buffer. Cell lysates (CL), precleared supernatants (SN), and VLP preparations (VLP prep) were analyzed by immunoblotting using antibodies directed to either EBOV GP, EBOV VP40, or TAFV NP. Western blot images were acquired using Kodak BioMax Light films (Sigma-Aldrich, Munich, Germany).

To obtain detailed visual information on MVA-driven EBOV VLP formation, ultrathin sections of infected HeLa cells were analyzed by transmission electron microscopy (TEM). At 24 h p.i. with MVA-BN-EBOV-VLP, several longitudinal and cross sections through filamentous structures were detected that resembled typical EBOV virions at the stage of budding from the plasma membrane (Fig. 4A). These virus-like structures differed from cellular filopodia by their consistently smaller diameters. Cellular filopodia were also present in MVA-infected control cells (Fig. 4B). Concentrated, purified VLP preparations from the supernatant of MVA-BN-EBOV-VLP-infected cells revealed the release of filamentous particles typical of EBOV VLPs (Fig. 4C). Immunoelectron microscopy (immuno-EM) labeling with an EBOV GP-specific monoclonal antibody (MAb) resulted in the decoration of the surfaces of the filamentous particles with gold beads, specifically identifying these particles as EBOV VLPs (Fig. 4C). No labeling of the filamentous particles was detectable using a Marburg virus (MARV) GP-specific antibody (data not shown), confirming the specificity of the labeling reaction. The concentrated supernatant of MVA-BN-EBOV-GP-infected cells contained some pleomorphic particles that were also labeled by the EBOV GP-specific antibody (Fig. 4D). Such nonfilamentous EBOV GP-positive particles were also present in the supernatant of MVA-BN-EBOV-VLP-infected cells (Fig. 4C, bottom left) and were most likely the result of a GP-dependent but VP40-independent budding process (15, 28). In preparations of supernatant from MVA-BN-infected cells, no GP-positive particles were detected (Fig. 4E). These findings indicate that the filamentous particle shown in Fig. 4C represents a bona fide Ebola VLP that was released from MVA-BN-EBOV-VLP-infected cells.

 

 

FIG 4

TEM analysis of EBOV VLPs in MVA-BN-EBOV-VLP-infected cells and of concentrated VLP preparations. (A and B) TEM analysis of ultrathin sections. HeLa cells were infected with MVA-BN-EBOV-VLP (A) or MVA-BN (B) at an MOI of 10, fixed 1 day p.i. with glutaraldehyde and osmium tetroxide, and embedded in Epon. Ultrathin sections were stained with uranyl acetate and lead citrate and analyzed by TEM. (C to H) Immuno-EM analysis of concentrated VLP preparations from supernatants of HeLa cells infected for 24 h at an MOI of 10 with MVA-BN-EBOV-VLP (C and F), MVA-BN-EBOV-GP (D and G), and MVA-BN (E and H). (C, D, and E) Samples were adsorbed to EM grids and incubated with anti-EBOV GP MAb 6D8 and subsequently with secondary anti-mouse IgG antibody coupled with 18-nm colloidal gold. (F, G, and H) Samples were adsorbed to EM grids and incubated with anti-EBOV GP MAb 6D8 and polyclonal rabbit anti-vaccinia virus B5 antibody. The antigen-bound primary antibodies were detected with anti-mouse IgG conjugated with 12-nm colloidal gold and anti-rabbit IgG antibody conjugated with 18-nm colloidal gold.

Vaccinia virus protein B5 is excluded from EBOV VLPs.

Vaccinia virus-encoded proteins of the outer membrane of the extracellular vaccinia virus (EV), including the B5 protein, have been shown to partly localize to the plasma membranes of infected cells (31). We therefore analyzed whether the B5 protein, an important component of the poxviral EV membrane, would also be incorporated into EBOV VLPs. Double immunogold labeling and TEM analysis of concentrated VLP preparations from MVA-BN-EBOV-VLP-infected cells revealed that the B5 protein (18-nm gold beads) was exclusively localized in nonviral particulate structures that did not overlap EBOV GP-positive particles (12-nm gold beads) (Fig. 4F), suggesting that this MVA protein is excluded from VLPs. This also applied to the pleomorphic particles released from MVA-BN-EBOV-GP-infected cells (Fig. 4G). After infection with MVA-BN, particulate structures were stained only by the 18-nm gold bead-conjugated antibody directed to B5 protein, but not with antibodies specifically recognizing the EBOV GP (Fig. 4H). Most likely, the B5 protein-positive structures represent membranous vesicles that were derived from cellular compartments like the Golgi apparatus, the trans-Golgi network, endosomes, or the plasma membrane. These data confirm previous observations showing that the formation of Ebola virus-like particles at the plasma membrane is a specific process that excludes other proteins from incorporation into the VLPs (13, 32, 33).

Incorporation of NP into EBOV VLPs.

EBOV NP is incorporated into VLPs formed by expression of homologous EBOV VP40 (34, 35). Although TAFV NP was expressed along with EBOV GP and EBOV VP40 by HEK 293T/17 cells infected with MVA-BN-EBOV-VLP (Fig. 1E and ​and3),3), cross sections of EBOV VLPs appeared to be “empty” (Fig. 4A), suggesting that the EBOV VLPs produced by MVA-BN-EBOV-VLP did not contain nucleocapsid-like structures. In order to analyze whether TAFV NP is incorporated into EBOV VP40-derived VLPs and whether it can enhance VLP formation in a species-independent fashion, a VLP formation assay based on plasmid-based EBOV NP and TAFV NP expression in MVA-infected cells was used. Plasmids encoding either TAFV NP or EBOV NP under the control of the vaccinia virus early-late promoter PrS were transfected into MVA-infected HEK 293T/17 cells, along with a plasmid encoding EBOV VP40 under the control of the same promoter.

Western blot analysis of the cell lysates demonstrated that VP40 levels were not grossly affected by coexpression of either EBOV NP or TAFV NP (Fig. 5A, top). To analyze whether NP and VP40 were released into the supernatant of transfected cells as part of VLPs, we removed soluble VP40 dimers and soluble NP by ultrafiltration through an Amicon Ultra 100-kDa cutoff filter. Analysis of such purified and concentrated supernatants showed that the amount of VLP-associated VP40 in purified supernatants was 3.2-fold enhanced by coexpression of EBOV NP. TAFV NP enhanced VLP release by 2.7-fold, suggesting that the two NPs did not significantly differ in this aspect (Fig. 5A, top). Compared to NP levels found in cell lysates, the proportions of VLP-associated NP in purified supernatants were also similar for EBOV NP (1/18) (Fig. 5A, middle) and TAFV NP (1/21) (Fig. 5A, bottom). Because two different NP-specific antibodies had to be used for Western blot analysis of EBOV NP and TAFV NP, the expression levels of the NPs could not be directly compared. To provide indications of equal expression levels of both NPs, we confirmed that EGFP, which is coexpressed from the NP-encoding plasmids, was present at similar levels (data not shown). In addition, TaqMan reverse transcriptase quantitative real-time PCR (RT-qPCR) indicated that transcript levels of EBOV NP and TAFV NP were very similar (data not shown). Thus, the capacities of TAFV NP and EBOV NP to enhance EBOV VLP formation appeared to be very similar.

 

 

 

FIG 5

Release of MVA-expressed EBOV VLPs and incorporation of NP. (A) HEK 293T/17 cells in 12 wells were infected with MVA-BN (MOI, 5) and subsequently transfected with plasmids encoding the indicated filoviral proteins under the control of a poxviral early/late promoter. After 17 h of infection/transfection, the cell supernatants were filtered and concentrated using Amicon Ultra 100K centrifugation columns according to the manufacturer's instructions. The adherent cells were lysed in 250 μl 1× Laemmli sample loading buffer. Cell lysates (CL) and Amicon column-purified supernatants (pur-SN) were analyzed by immunoblotting using antibodies directed to either TAFV NP, EBOV VP40, or EBOV NP. For detection of TAFV NP (bottom gel), a chemiluminescent substrate with enhanced sensitivity was used. (B) For analysis of B5 expression, cells were treated as described for panel A; an uninfected mock control was included as a control. A Western blot of CL and pur-SN was probed with a polyclonal rabbit anti-vaccinia virus B5 antibody. All the Western blot images were acquired using the ChemiDoc Touch System, and the images were analyzed and the signals quantified with Image Lab Software. The data shown are representative of the results of at least three independent experiments.

The presence of B5 in nonviral particulate structures of EBOV VLP preparations and in purified supernatants of MVA-infected cells not generating EBOV VLPs (Fig. 4F to ​toH)H) was also confirmed by Western blotting. Expression of filovirus proteins EBOV VP40, EBOV NP, and TAFV NP in MVA-BN-infected cells did not affect the release of B5 into supernatants (Fig. 5B), while VP40 release was enhanced by NP (Fig. 5A). This result supports the notion that B5 was not incorporated into VP40-driven EBOV VLPs but rather was secreted by a different and spatially separated mechanism. Likely, B5 was contained in exosome-like vesicles that have previously been reported to be released from MVA-infected cells (36).

Detection of nucleocapsid-like structures in MVA-driven EBOV VLPs.

Coexpression of NP with VP40 results in the formation of a nucleocapsid-like structure visible as an inner ring in electron micrographs of VLP cross sections (35), termed a “bull′s eye” by Johnson et al. (34). We were unable to discern nucleocapsid-like structures in cross sections of VLPs produced by cells infected with MVA-BN-EBOV-VLP (Fig. 4A and data not shown), although TAFV NP was detected in VLPs, as indicated by Western blotting (Fig. 3). Using the transfection approach described above, we compared the morphology of VLPs in ultrathin sections of HeLa cells expressing EBOV VP40, along with either EBOV NP or TAFV NP. Cross sections of VLPs generated in the presence of EBOV NP clearly revealed nucleocapsid-like ring structures (Fig. 6A), indicating that EBOV NP had been incorporated into VLPs. In contrast, most VLPs generated in the presence of TAFV NP either appeared empty (Fig. 4A and ​and6B)6B) or were filled with an amorphous structure or sometimes with an irregular-shaped, but not ring-like, structure (data not shown). When 18 cross sections through VLPs released from VP40- and EBOV NP-expressing cells were analyzed, 9 had a clear inner ring, 8 showed a central irregular-shaped structure, and 1 was empty. In contrast, of 77 cross sections of EBOV VLPs that were generated in the presence of TAFV NP (either by MVA-BN-EBOV-VLP infection or by VP40/TAFV NP plasmid-based coexpression), 65 were empty, 11 had some internal irregular structure, and only 2 showed a ring-like structure.

 

FIG 6

Transmission EM analysis of transfected VLP-producing cells. HeLa cells in 6 wells were infected with MVA-BN (MOI, 5) and subsequently transfected with plasmids encoding EBOV VP40 and EBOV NP (A) or EBOV VP40 and TAFV NP (B). At 12 h p.i., cells were harvested by scraping and fixed with 2.5% glutaraldehyde. Ultrathin sections of the fixed cells were prepared and analyzed by transmission EM. (A) The boxed area of the photomicrograph is shown at higher magnification at the lower right. The arrowheads indicate VLPs with an inner nucleocapsid-like structure appearing as a central ring (bull's eye). A cross-section through a cellular filopodium is marked with an arrow. (B) The arrowheads point to “empty” VLP cross sections. Note that only VLPs clearly showing a dark outer boundary were cut exactly in the perpendicular plane and therefore could reveal an inner ring.

We conclude from these findings that the incorporation of NP into EBOV VLPs and the enhancement of release of EBOV VP40 VLPs occurs species independently in the genus Ebolavirus (Fig. 3 and ​and5A).5A). The results from our EM analyses suggest, however, that the characteristic inner ring structure is efficiently formed only if the homologous EBOV NP is present.

Induction of GP-binding and neutralizing antibodies by MVA-BN-EBOV-VLP in mice.

Since EBOV GP-specific antibody responses are considered most important for assessing the protective potential of EBOV vaccine candidates (16, 17), we compared the induction of EBOV GP-specific antibodies in CBA/J mice following immunization with MVA-BN-EBOV-VLP and MVA-BN-EBOV-GP. The mice were vaccinated intramuscularly on days 0 and 28, and binding and neutralizing antibody responses on days 21, 42, and 56 were analyzed by enzyme-linked immunosorbent assay (ELISA) and by plaque reduction neutralization test 50 (PRNT50) using chimeric VSV-EBOV-GP as a surrogate virus. Binding or neutralizing antibody titers of the immune sera from the two mouse groups did not significantly differ at any time after priming or boosting (Fig. 7A and ​andBB and data not shown). To evaluate one qualitative aspect of the antibody response, we analyzed the levels of EBOV GP-specific isotypes IgG1 and IgG2a. Although there appeared to be a tendency toward lower IgG1 and higher IgG2a levels of MVA-BN-EBOV-VLP-induced GP-specific antibodies than the respective IgG1 and IgG2a titers induced by MVA-BN-EBOV-GP (Fig. 7C and ​andD),D), all of these differences were not statistically significant, and the tendency was undetectable in a second, independent mouse experiment. These results suggest that in this animal model, with the route and vaccine dose used, EBOV VLP formation by a recombinant MVA vector did not significantly enhance the induction of EBOV GP-specific antibodies or alter the IgG1/IgG2a isotype ratio compared to MVA-driven expression of EBOV GP alone.

 

Open in a separate window

FIG 7

EBOV GP-specific antibody responses in mice following immunization with MVA-BN-EBOV-VLP. CBA/J mice (group size, 5) were immunized intramuscularly in the hind leg on days 0 and 28 with either MVA-BN-EBOV-GP (GP) or MVA-BN-EBOV-VLP (VLP). Sera were sampled on days (d) 21, 42, and 56 and analyzed by PRNT50 using recombinant VSV-EBOV-GP as a surrogate virus (A) and for antigen-binding antibodies by EBOV GP-specific ELISA for total IgG (B), IgG1 (C), and IgG2a (D). Differences were not statistically significant. The PRNT and ELISA results shown are from one of two representative independent experiments. *, analysis of pooled sera from five mice. The error bars indicate standard errors of the means.

GP-specific CD8 T cell response.

The EBOV GP-specific CD8 T cell response following a prime-boost immunization regimen was analyzed in CBA/J mice, since the GP-derived CD8 T cell epitope inducing the strongest responses has been reported to occur in the H-2k haplotype. Shown in Fig. 8 is the GP-specific memory CD8 T cell response determined by intracellular staining of splenocytes for the cytokines gamma interferon (IFN-γ), tumor necrosis factor alpha (TNF-α), and interleukin 2 (IL-2), as well as by surface staining of the degranulation marker CD107a, at day 28 after the last immunization. There was a moderately lower frequency of GP-specific CD8 T cells in the spleens of MVA-BN-EBOV-VLP-immunized mice than in those of MVA-BN-EBOV-GP-immunized mice. This moderate difference was statistically significant between the two groups immunized by the intravenous (i.v.) route for most of the markers, except IL-2 (Fig. 8), but not in mice immunized by the intramuscular (i.m.) route. In contrast, the geometric mean fluorescence intensity of the signals for intracellular IFN-γ and TNF-α were slightly higher in CD8 T cells of MVA-BN-EBOV-VLP-immunized mice independent of the immunization route (Fig. 8). This difference was again statistically significant between the two i.v. immunized groups. The average total numbers of GP-specific CD8 T cells in the spleens of the two groups were similar (data not shown), reflecting the frequency results shown in Fig. 8. The frequencies of GP-specific CD8 T cells in blood on days 8 and 5 after prime and boost, respectively, determined by dextramer staining were also very similar in the two groups independent of the immunization route (data not shown). In conclusion, the GP-specific CD8 T cell response induced by MVA-BN-EBOV-VLP was comparable to that induced by MVA-BN-EBOV-GP. The slightly lower frequency of GP-specific T cells in the spleen induced by MVA-BN-EBOV-VLP might be explained by the strong expression of the two additional potential CD8 T cell targets, VP40 and NP.

 

 

FIG 8

EBOV GP-specific CD8 T cell responses in mice following MVA-BN-EBOV-VLP immunization. CBA/J mice (group size, 5) were immunized on days 0 and 28 with either MVA-BN-EBOV-GP (GP) or MVA-BN-EBOV-VLP (VLP) by the i.m. or i.v. route. Mice were sacrificed at day 56, and spleen cell suspensions were restimulated in vitro with EBOV GP-derived peptide (TELRTFSI). The cells were stained for expression of CD4, CD8, CD44, and CD107a, and production of IFN-γ, TNF-α, and IL-2 was analyzed after intracellular cytokine staining by flow cytometry. The percentages of CD8 T cells expressing CD107a, IFN-γ, TNF-α, or IL-2 are shown on the left, and geometric mean fluorescence intensities (GMFI) of the signals for CD107a, IFN-γ, TNF-α, and IL-2 are shown on the right. *, P < 0.05 by unpaired two-tailed Student's t test. The error bars indicate standard errors of the means.

Go to:

DISCUSSION

VLPs represent a vaccine modality with excellent immunogenicity and efficacy, as demonstrated by successful vaccination programs employing approved VLP-based vaccines for protection against human papillomavirus-induced cervical cancer and hepatitis B (37). With respect to filoviruses, EBOV VLPs and MARV VLPs have been shown to provide protection from EVD and MARV disease, respectively, in a number of animal models, including the NHP model (11, 38,–41), which represents the best available animal model for human EVD. Protection of NHPs was initially achieved with a three-dose immunization regimen and involved the use of adjuvants (11, 38). A follow-up study showed that two immunizations with adjuvanted Ebola VLPs were already sufficient to protect NHPs from EBOV challenge (41). In the present study, we generated and characterized a novel MVA-BN-based vaccine vector that simultaneously expressed three Ebola virus proteins driving the formation of Ebola virus-like particles in vector-infected cells.

There is evidence from published literature showing that MVA might interfere with efficient transport of MARV GP along the secretory pathway in human cells (42). Since budding of EBOV VLPs takes place at the plasma membrane, such deficiency in transport competence might result in VLPs lacking GP. However, EBOV GP expressed by MVA, either alone or in combination with VP40 and NP, was properly processed and transported to the cell surface, providing authentic GP antigen for VLP incorporation. In fact, the MVA-driven EBOV VLPs were found to be decorated with GP spikes at high density (Fig. 4C and ​andF),F), indicating that MVA did not interfere with incorporation of the viral glycoprotein into VLPs.

Foreign envelope glycoproteins from HIV, murine leukemia virus, and VSV have been shown to be copackaged with EBOV GP into retrovirus pseudotype particles because the viral GPs were recruited to the same assembly and budding sites at the plasma membrane (43). Interestingly, the poxvirus glycoprotein B5 was not detected in EBOV VLPs in our study. Although B5 is able to reach the plasma membranes of vaccinia virus-infected cells, it is actively retrieved from the cell surface and redirected to the Golgi compartment (31), where wrapping of mature poxviral particles with additional membranes takes place (44, 45). Hence, poxviral and filoviral membrane-associated proteins accumulate and assemble at distinct cellular membrane compartments, which explains why B5 is absent from EBOV VLPs that were released from MVA-EBOV-VLP-infected cells.

The NP of filoviruses has been shown to accumulate in cytoplasmic inclusion bodies, forming densely packed helical structures with a diameter of 20 to 25 nm (35, 46). Using confocal immunofluorescence analysis, we observed similar inclusion bodies in cells infected with MVA-BN-EBOV-VLP or following transfection of cells with plasmids encoding EBOV VP40 and EBOV NP. These inclusion bodies were intensely stained with antibodies specifically reacting with the respective NP (Fig. 2 and data not shown). In addition, ultrathin sections of MVA-BN-EBOV-VLP-infected cells contained large aggregates consisting of nucleocapsid-like helical structures (data not shown). In contrast to some published reports (18, 29), we did not observe redistribution of the homologous EBOV NP from inclusion bodies to sites of EBOV VP40 accumulation at the plasma membrane when MVA-infected cells were cotransfected with plasmids encoding EBOV NP and EBOV VP40 (data not shown). In addition, cells infected with MVA-BN-EBOV-VLP also showed large inclusion bodies consisting of NP (Fig. 2), similar to what has been reported for EBOV-infected and MARV-infected cells (46, 47). Using a purely plasmid-driven system, Hoenen et al. also observed that inclusion bodies formed by NP in human Huh-7 cells remained stable when VP40 was coexpressed and that, rather, some VP40 was associated with the NP inclusion bodies (48). We therefore assume that the complete resolution of the large NP inclusion bodies might require very strong VP40 expression that is apparently achieved neither in natural infection nor in most expression systems, including ours. The fact that we did not observe resolution of NP inclusion bodies by VP40 coexpression does not exclude NP-VP40 interactions between a fraction of VP40 and NP molecules. Such interactions did apparently occur, as evidenced by the incorporation of TAFV NP, as well as EBOV NP, into MVA-driven EBOV VLPs (Fig. 3 and ​and5)5) and by the productive infection of cells with EBOV and MARV despite persistence of NP inclusion bodies.

VP40 is a major player in filovirus budding and VLP formation (12,–15). Even if VLP formation is triggered by VP40 of MARV, i.e., a virus from a different filoviral genus, EBOV GP is efficiently incorporated into VLPs (49). This finding is most likely attributable to the fact that a direct interaction of GP and VP40 is not required for GP incorporation into VLPs. Rather, GP is targeted to the same lipid raft domains that VP40 associates with (12, 50, 51). It has been shown in cotransfection experiments that EBOV NP enhances the efficacy of homologous EBOV VP40-driven VLP formation and that it is incorporated into VLPs independently of GP (18, 19). Incorporation of the RNP complex, of which NP is a major component, has been shown to occur in a genus-specific manner (52).

There is also evidence that NP and VP40 directly interact via both C-terminal and N-terminal domains of NP, with the C terminus being most critical for packaging of nucleocapsids into EBOV particles (29, 52). Since the NP amino acid sequences differ by at least 30% between Ebola virus species and sequence variations are most pronounced at the C terminus, it was unclear whether packaging of a heterologous NP from a different Ebola virus species would occur. In the MVA-BN-EBOV-VLP construct investigated here, the gene encoding the heterologous TAFV NP had been inserted to broaden the species coverage of the vaccine construct with respect to cellular immune responses. Our data suggest that both the heterologous TAFV NP and the homologous EBOV NP were able to enhance VLP formation (Fig. 3 and ​and5).5). Western blot analyses suggested that both NPs were present in VLPs, whereas definite ring-like nucleocapsid structures in VLP cross sections could be clearly discerned by EM analysis only when EBOV NP was used (Fig. 6). Direct comparison of the EBOV NP or TAFV NP expression levels and presence in VLPs by Western blotting was not feasible because different antibodies were required for detection. However, EGFP marker analysis and qPCR data indicated similar cellular expression levels of NPs. It will be of interest to determine whether the formation of nucleocapsid-like structures by TAFV NP and EBOV NP requires different viral cofactors or whether TAFV nucleocapsids are morphologically distinct from EBOV nucleocapsids.

The immune correlates of vaccine-induced protection against EVD are still not well defined, but multiple studies in NHPs, as well as observations made with human EVD patients, indicate that antibodies are important in protection against EVD (17, 53). We therefore determined the antibody responses induced by the MVA-BN-EBOV-VLP vaccine in mice (Fig. 7). Our basic analysis indicated that there was no significant difference between the amounts of GP-specific binding or neutralizing antibodies or the GP-specific IgG1/IgG2a isotype ratios induced by MVA-BN-EBOV-VLP and MVA-BN-EBOV-GP. However, the advantage of the VLP approach might reside in the quality of the vaccine antigen and thus the quality of the antibody response. Antibodies may protect from EVD by directly neutralizing the virus, but nonneutralizing antibodies can also be protective (54). One potential mechanism of protection by nonneutralizing antibodies may rely on the inhibition of filovirus particle release from cells (55). NK cell-mediated antibody-dependent cellular cytolysis (ADCC), complement-mediated cell lysis, and macrophage-mediated antibody-dependent cellular phagocytosis (ADCP) might also contribute to protection by antibodies. Furthermore, mice are not known to be natural hosts for filoviruses, and the quality and quantity of antibodies induced by MVA-BN-EBOV-VLP in primates may show greater differences from those induced by MVA-BN-EBOV-GP than in mice. An investigation of the potential of MVA-BN-EBOV-VLP to induce antibodies that exert protective functions, such as ADCC or ADCP, is warranted.

CD8 T cell responses are thought to contribute to protection against EVD, and MVA is recognized as a potent inducer of CD8 T cell responses. We found that the frequencies of GP-specific CD8 T cells in the blood and in the spleen at different time points after immunization were very similar or possibly even somewhat lower in mice vaccinated with MVA-BN-EBOV-VLP than in those vaccinated with MVA-BN-EBOV-GP (Fig. 8 and data not shown). This slightly lower GP-specific response might have occurred due to the strong expression by the MVA-BN-EBOV-VLP construct of two additional filoviral antigens, VP40 and NP, which are predicted to contain good CD8 T cell epitopes in the H-2k background. We did not attempt to define VP40- and NP-derived epitopes in this background, but should such immunogenic epitopes exist, it is conceivable that the CD8 T cell response against these antigens would compete with that against GP and would likely reduce the GP-specific response. A similar phenomenon was observed, e.g., for the CD8 T cell response against the B8 MVA antigen, which was reduced depending on the strength of early ovalbumin expression in the H-2b background (56). It is thus possible that the GP-specific CD8 T cell response induced by MVA-BN-EBOV-VLP might be similar or even higher without this competition effect than single GP expression. On the other hand, the MVA-BN-EBOV-VLP vaccine construct could possibly induce a broader CD8 T cell response against filovirus antigens.

In summary, we found that the MVA vaccine vector allows efficient formation and release of bona fide GP-spiked EBOV VLPs and efficiently induces GP-specific antibody and T cell responses. The MVA-filovirus VLP platform might be further armed with additional GP antigens derived from different Ebola virus species, as well as from MARV, to ultimately generate a multivalent and highly immunogenic panfilovirus vaccine.

Go to:

MATERIALS AND METHODS

Cells, viruses, and antibodies.

The human cervical carcinoma HeLa (CCL-2), human embryonic kidney HEK 293T/17 (CRL-11268), and baby hamster kidney BHK-21 (CCL-10) cell lines were obtained from ATCC. Vero E6 cells were obtained from the European Cell Culture Collection via Sigma (catalog no. 85020206). All the cell lines were cultivated in Dulbecco's modified Eagle medium (DMEM) (Gibco/Invitrogen, Darmstadt, Germany) supplemented with 10% fetal calf serum (FCS) (Pan Biotech, Aidenbach, Germany). Primary chicken embryo fibroblasts (CEFs) were prepared from 11-day-old embryonated chicken eggs and cultured in VP-SFM (Gibco) for virus stock production or in RPMI supplemented with 7% FCS for titration assays. The MVA used in this study was either MVA-BN (Bavarian Nordic GmbH, Munich, Germany) or a wt MVA that was derived from a bacterial artificial chromosome (BAC) clone constructed from MVA-BN. The properties of the latter, containing a BAC cassette including an NPT II-internal ribosome entry site (IRES)-EGFP array of selectable markers, were indistinguishable from those of MVA-BN (57). MVA-BN, MVA-BN recombinants, and wt MVA were propagated on primary or secondary CEFs and titrated on secondary CEFs using the 50% tissue culture infective dose (TCID50) method as described previously (58). The murine monoclonal antibodies 6D8 against EBOV GP and 9G4 against MARV Musoke GP were obtained from J. Biggins (U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, MD, USA). The anti-TAFV NP antibody was generated for Bavarian Nordic by BioGenes GmbH, Berlin, Germany, against a TAFV NP-derived peptide with the sequence CVSGSENTDNKPHSE. Rabbit polyclonal anti-EBOV NP (0301-012) and anti-EBOV VP40 (0301-010) antibodies were obtained from IBT Bioservices, Gaithersburg, MD, USA. The rabbit polyclonal B5-specific antibody was a gift from Robert Drillien, Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), Illkirch-Graffenstaden, France.

Generation of recombinant viruses.

MVA-BN-EBOV-GP and MVA-BN-EBOV-VLP recombinants were generated using transient dominant selection (59) according to standard procedures. The cDNAs encoding VP40 and GP of Zaire ebolavirus variant Mayinga and NP of TAFV were synthesized by Invitrogen GeneArt (Regensburg, Germany). The recombinant viruses still contained the NPT II/RFP cassette (MVA-BN-EBOV-GP) or both cassettes (MVA-BN-EBOV-VLP). Recombinant EBOV VP40 and TAFV NP expression was driven by the PrS promoter (24), while the EBOV GP gene was under the control of the PrS5E promoter containing five additional tandem repeats of the p7.5k promoter (25) in both MVA recombinants. A recombinant chimeric VSV (VSV-EBOV-GP) was generated by replacing the VSV G gene with the EBOV GP gene (variant Mayinga) according to published procedures (60). VSV-EBOV-GP also expressed EGFP from an additional transcription cassette downstream of the GP gene. In addition, VSV-EBOV-GP carried a modified VSV M gene containing 4 point mutations (MQ) known to reduce the cytotoxicity of the virus and to induce type I IFN in IFN-competent cells (61). VSV-EBOV-GP was propagated and titrated on Vero and BHK-21 cells.

Transient transfections.

cDNAs optimized for human codon usage encoding EBOV VP40, EBOV NP, and TAFV NP were synthesized by GeneArt (Regensburg, Germany) and subcloned into MVA recombination plasmids (Bavarian Nordic, Munich, Germany) under the control of the synthetic PrS vaccinia virus promoter. For cellular expression, subconfluent cells in 12-well tissue culture plates were infected with MVA-BN at a multiplicity of infection (MOI) of 5. At 1 h p.i., the cells were transfected with FuGene HD/6 (Promega, Mannheim, Germany) according to the manufacturer's instructions, using a total of 3 μg plasmid DNA and 9 μl of transfection reagent per well.

Glycosylation analysis.

Infected cells were lysed in RIPA buffer (New England BioLabs, Frankfurt, Germany), and the cell lysates were divided into three aliquots and treated with either Endo H or PNGase F (New England BioLabs, Frankfurt, Germany) according to the manufacturer's instructions or mock treated. For Western blot analysis, samples were mixed with 3× Laemmli sample loading buffer.

Immunoblot analysis of EBOV and TAFV proteins.

HeLa and HEK 293T/17 cells were seeded on the day before infection. Inoculation, cell lysate preparation, immunoblotting, immunodetection, and stripping were performed as previously described (62). For SDS-PAGE, 7.5% Mini-Protean TGX polyacrylamide gels were used (Bio-Rad, Munich, Germany). The antibodies used for immunodetection were diluted as follows: anti-EBOV GP MAb 6D8, anti-EBOV VP40, and anti-EBOV NP, 1:1,000, and anti-TAFV NP, 1:10,000. Detection of protein bands by enhanced chemiluminescence (ECL) was carried out with two alternative substrate reagents, depending on signal strength: SuperSignal West Pico (Thermo Scientific, Bonn, Germany) as the standard reagent and an ECL Advance Western blotting detection kit (GE Healthcare, Munich, Germany) for detection with higher sensitivity. Western blot images were acquired using Kodak BioMax Light Films (Sigma-Aldrich, Munich, Germany) or the ChemiDoc Touch System and Image Lab software (Bio-Rad, Munich, Germany) for image analysis and quantification.

Reverse transcriptase quantitative real-time PCR.

Infection/transfection controls for RT-qPCR were set up in triplicate per condition, and RNA from 1 × 106 to 1.5 × 106 infected HEK293T/17 cells per sample was isolated as previously described (63). Reverse transcription of 3 μl of isolated RNA was performed using the Omniscript RT kit (205113; Qiagen) in the presence of an RNase inhibitor (R2520; Sigma-Aldrich) at a final concentration of 10 U/μl for 70 min at 37°C using random nonamer primers at a final concentration of 5 μM (R7647; Sigma-Aldrich). One microliter of RT reaction mixture was added to 20 μl of total PCR mixture for quantitative real-time PCR based on the TaqMan Gene Expression master mix (4369016; Life Technologies, Darmstadt, Germany) according to the manufacturer's instructions. Quantitative PCR of cDNA was performed using the following primers and TaqMan probes: EBOV-NP fw primer, GCAGTCTGTCGGGCATATGA (final concentration, 500 nM); EBOV-NP rev primer, CTTTCAGTCTTTTGGAGGATGTG (final concentration, 500 nM); EBOV-NP probe, 6-carboxyfluorescein (FAM)-TCAAGGCATGCATATGGTCGCC-MGBNFQ (final concentration, 252 nM); TAFV-NP fw primer, GAGCGTGGGCCACATGA (final concentration, 500 nM); TAFV-NP rev primer, TCGGTTTTCTGCAGGATGTG (final concentration, 500 nM); TAFV-NP probe, FAM-CCAGGGAATGCACATGGTGGCT-MGBNFQ (final concentration, 252 nM). The EBOV NP- and TAFV NP-specific primer/probe sets were used as a 1:1 mixture in a multiplex qPCR. Input cDNA was normalized using TaqMan gene expression assay 18S (Hs99999901_s1) detecting eukaryotic 18S rRNA transcripts. All real-time qPCRs were performed in duplicate using an Applied Biosystems 7500 real-time PCR system with initial incubation at 50°C for 2 min (uracil DNA glycosylase activation), 10-min incubation at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. No-template controls and minus-RT controls were uniformly negative. Fold transcription of NP was calculated relative to cells not expressing NP. Threshold cycle (CT) values were arbitrarily set to 36 if the CT value was undetermined or >36.

Flow cytometry.

Infected and uninfected cell monolayers were washed with PBS, and single-cell suspensions were prepared by scraping and thoroughly resuspending the cells. The cells were washed and resuspended in ice-cold PBS containing 2% FCS and stained using anti-EBOV GP monoclonal antibody 6D8 (1:2,500), followed by staining with an allophycocyanin-coupled anti-mouse secondary antibody (1:1,000). Cells were analyzed for GP surface expression, as well as cytoplasmic EGFP and RFP expression, by flow cytometry using an LSR II flow cytometer (BD Biosciences, Heidelberg, Germany) and FlowJo software (Tree Star Inc., Ashland, OR, USA).

Preparation of EBOV VLPs.

EBOV VLPs in supernatants of MVA-BN-EBOV-VLP-infected cells were concentrated and purified by centrifugation through a 20% sucrose cushion at 36,000 rpm in a Beckmann SW41 rotor for 2 h. The pellet was thoroughly resuspended in ice-cold PBS containing protease inhibitor cocktail (Roche Complete; Sigma-Aldrich, Munich, Germany) by initial vortexing and then rotating the samples for 1 h at 4°C.

Confocal immunofluorescence analysis of recombinant EBOV protein expression.

HeLa cells were grown on 12-mm coverslips (0.17 mm thick), infected at an MOI of 10 with the recombinant MVA vectors, and fixed 6 h p.i. with 3.7% formaldehyde in PBS. After permeabilization with PBS containing 0.1% Triton X-100, the cells were blocked with PBS supplemented with 3% bovine serum albumin (PBS-BSA). The cells were incubated with the corresponding antibodies diluted in PBS-BSA: murine monoclonal antibody 6D8 against EBOV GP, 1:200; rabbit polyclonal anti-TAFV NP antibody, 1:500; and rabbit polyclonal anti-EBOV VP40, 1:250. As secondary antibodies, goat anti-rabbit IgG(H+L)-Alexa Fluor 405 or goat anti-mouse IgG(H+L)-Alexa Fluor 633 (Molecular Probes, Invitrogen, USA) was used at a dilution of 1:500. After washing with PBS and H2O, the coverslips were mounted in Prolong Gold (Molecular Probes, Invitrogen). Samples were analyzed using a confocal laser scanning microscope (SP8; Leica Microsystems, Wetzlar, Germany; 63× oil objective).

Immunoelectron microscopy.

For immuno-EM, samples were adsorbed to carbon-coated Parlodion films mounted on 300 mesh/inch copper grids (EMS, Fort Washington, PA, USA) for 10 min, blocked with PBS containing 0.1% BSA (PBS-BSA/0.1%) for 10 min, incubated with the primary antibody diluted in PBS-BSA/0.1% (murine monoclonal antibody 6D8 against EBOV GP, 1:50; murine monoclonal antibody 9G4 against MARV GP, 1:50; or rabbit polyclonal anti-B5, 1:400) for 1 h, washed several times with PBS-BSA/0.1%, incubated with the secondary anti-IgG antibody coupled to 12- or 18-nm colloidal gold beads (Jackson ImmunoResearch, West Grove, PA, USA) diluted 1:15 (18 nm) or 1:30 (12 nm) in PBS-BSA/0.1%, washed several times with PBS and H2O, and stained with 2% phosphotungstic acid (PTA), pH 7.0 (Aldrich, Steinheim, Germany) for 1 min. Specimens were analyzed in a transmission electron microscope (CM12; Philips, Eindhoven, Netherlands) equipped with a charge-coupled device (CCD) camera (Ultrascan 1000; Gatan, Pleasanton, CA, USA) at an acceleration voltage of 100 kV.

Preparation and analysis of ultrathin sections.

HeLa cells grown either on sapphire disks or in 6-well tissue culture plates were infected at an MOI of 10 with the recombinant MVA vectors. After 12 to 24 h, the cells were scraped into the medium and the cell pellet was fixed in 2.5% glutaraldehyde (GA) by centrifugation for 20 min at 4,000 × g, or the sapphire disks were fixed in 2.5% GA for 1 h at 4°C before embedding in Epon according to a standard protocol (64). Briefly, after fixation with 2.5% GA, the cells were postfixed with 1% osmium tetroxide (OsO4); dehydrated in a graded ethanol series starting at 70%; and, after two changes in acetone, embedded in Epon. Ultrathin sections were stained with uranyl acetate and lead citrate and analyzed as described above with a transmission electron microscope (CM12; Philips, Eindhoven, Netherlands) equipped with a CCD camera (Ultrascan 1000; Gatan, Pleasanton, CA, USA) at an acceleration voltage of 100 kV.

ELISA and PRNT50.

For immunization, 6- to 8-week-old CBA/J mice (Janvier Laboratories, Le Genest Saint Isle, France) were used (group size, 5). The animals were immunized intramuscularly in the hind leg with 108 TCID50 of either MVA-BN-EBOV-GP or MVA-BN-EBOV-VLP in 50 μl sterile PBS on days 0 and 28. Blood samples were taken on days 21, 42, and 56, and serum was prepared to determine Ebola virus GP-specific IgGs by direct ELISA. Ninety-six-well plates were coated overnight with recombinant EBOV GP antigen (total IgG, 0.625 μg/ml; IgG1, 0.64 μg/ml; IgG2a, 0.32 μg/ml) (IBT Bioservices, Rockville, MD, USA). Test sera were titrated in duplicate using 2-fold serial dilutions. The plates were incubated for 1 h at room temperature, washed, and incubated for 1 h with detection antibody—sheep or goat anti-mouse IgG-horseradish peroxidase (HRP), IgG1-HRP, or IgG2a-HRP (1:2,000 dilution; Bio-Rad, Munich, Germany). The plates were washed and developed using 3,3′5,5′-tetramethylbenzidine at room temperature in the dark; the reaction was stopped after 30 min (total IgG) or 15 min (IgG1/Ig2a) using H2SO4 and read out at 450 nm (Tecan Sunrise ELISA plate reader).

For PRNT50, a chimeric VSV construct in which the authentic G spike glycoprotein was replaced by EBOV GP was used to determine the titer of EBOV-neutralizing antibodies in sera of immunized mice. Serial dilutions of mouse antiserum were incubated in duplicate with ∼100 to 150 PFU of VSV-EBOV-GP per dilution and plated on Vero cells for 3 days. The monolayers were stained with crystal violet and scanned with a flatbed scanner. The electronic images of the monolayers were then analyzed by neuronal network software (NN plate count, developed in house), recognizing and counting the plaques and calculating the PRNT50.

The results were analyzed by an unpaired two-tailed Student t test. P values of <0.05 were considered statistically significant.

EBOV GP-specific CD8 T cell response.

CBA/J mice were immunized by i.m. or i.v. application of 108 TCID50 of MVA-BN-EBOV-GP or MVA-BN-EBOV-VLP on days 0 and 28 (group size, 5). The CD8 T cell response to the immunodominant GP epitope in the H-2k haplotype (TELRTFSI) was determined by dextramer staining of peripheral blood mononuclear cells on days 8 and 5 after prime and boost, respectively. For intracellular cytokine staining, immunized mice were sacrificed at day 56 (28 days after the last immunization), spleens were harvested on ice, and mononuclear spleen cell suspensions were prepared. The cells were incubated with 5 μg/ml of major histocompatibility complex (MHC) class I-restricted EBOV GP-derived peptide (TELRTFSI) (GenScript, Piscataway, NJ, USA) for 5 to 6 h at 37°C in complete RPMI in the presence of 1 μl/ml GolgiPlug (BD Biosciences, Heidelberg, Germany) and anti-CD107 (fluorescein isothiocyanate [FITC]) (BioLegend, San Diego, CA, USA). Cell surface marker expression was analyzed with anti-CD4 (BV650), anti-CD8 (BV785) (both BioLegend), and anti-CD44 (allophycocyanin [APC]-eFluor780) (eBiosciences, San Diego, CA, USA) antibodies. For live/dead cell discrimination, cells were stained with a LIVE/DEAD fixable aqua dead cell staining kit according to the manufacturer's instructions (Life Technologies GmbH, Darmstadt, Germany). Intracellular cytokine staining of IFN-γ (phycoerythrin [PE]-Cy7), TNF-α (peridinin chlorophyll protein [PerCP]-eFluor710), and IL-2 (APC) (all from eBiosciences) was performed after fixation and permeabilization according to the manufacturer's instructions (BD Cytofix/Cytoperm; BD Biosciences). Flow cytometric analysis was performed using a digital LSR II (BD Biosciences). Data were analyzed with FlowJo software (Tree Star Inc., Ashland, OR, USA). Results were analyzed by an unpaired two-tailed Student t test. P values of <0.05 were considered statistically significant.

Go to:

ACKNOWLEDGMENTS

  1. Schweneker, S. Wagner, M. Wolferstätter, M. Klingenberg, U. Dirmeier, R. Steigerwald, H. Lauterbach, H. Hochrein, P. Chaplin, and J. Hausmann are employees of Bavarian Nordic GmbH, which is the funding corporation for this study. M. Suter is a consultant to Bavarian Nordic. P. Chaplin is a shareholder of Bavarian Nordic.

We thank Jutta Kramer and Johannes Poddobrjanski for producing purified viral stocks, Sebastian Kraus and Marlene Geiger for excellent technical assistance, and Yvonne Terkowski and Christian Krause for their help with the animal experiments (all from Bavarian Nordic GmbH).

Go to:

REFERENCES

  1. Groseth A, Feldmann H, Strong JE. 2007. The ecology of Ebola virus. Trends Microbiol 15:408–416. doi:10.1016/j.tim.2007.08.001. [PubMed] [CrossRef] [Google Scholar]
  2. Rougeron V, Feldmann H, Grard G, Becker S, Leroy EM. 2015. Ebola and Marburg haemorrhagic fever. J Clin Virol 64:111–119. doi:10.1016/j.jcv.2015.01.014. [PubMed] [CrossRef] [Google Scholar]
  3. Kuhn JH, Becker S, Ebihara H, Geisbert TW, Johnson KM, Kawaoka Y, Lipkin WI, Negredo AI, Netesov SV, Nichol ST, Palacios G, Peters CJ, Tenorio A, Volchkov VE, Jahrling PB. 2010. Proposal for a revised taxonomy of the family Filoviridae: classification, names of taxa and viruses, and virus abbreviations. Arch Virol 155:2083–2103. doi:10.1007/s00705-010-0814-x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  4. Geisbert TW, Geisbert JB, Leung A, Daddario-DiCaprio KM, Hensley LE, Grolla A, Feldmann H. 2009. Single-injection vaccine protects nonhuman primates against infection with marburg virus and three species of ebola virus. J Virol 83:7296–7304. doi:10.1128/JVI.00561-09. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  5. WHO Ebola Response Team. 2016. After Ebola in West Africa; unpredictable risks, preventable epidemics. N Engl J Med 375:587–596. doi:10.1056/NEJMsr1513109. [PubMed] [CrossRef] [Google Scholar]
  6. Marzi A, Robertson SJ, Haddock E, Feldmann F, Hanley PW, Scott DP, Strong JE, Kobinger G, Best SM, Feldmann H. 2015. VSV-EBOV rapidly protects macaques against infection with the 2014/15 Ebola virus outbreak strain. Science 349:739–742. doi:10.1126/science.aab3920. [PubMed] [CrossRef] [Google Scholar]
  7. Milligan ID, Gibani MM, Sewell R, Clutterbuck EA, Campbell D, Plested E, Nuthall E, Voysey M, Silva-Reyes L, McElrath MJ, De Rosa SC, Frahm N, Cohen KW, Shukarev G, Orzabal N, van Duijnhoven W, Truyers DWC, Bachmayer N, Splinter D, Samy N, Pau MG, Schuitemaker H, Luhn K, Callendret B, Van Hoof J, Douoguih M, Ewer K, Angus B, Pollard AJ, Snape MD. 2016. Safety and immunogenicity of novel adenovirus type 26- and modified vaccinia ankara-vectored Ebola vaccines: a randomized clinical trial. JAMA 315:1610–1623. doi:10.1001/jama.2016.4218. [PubMed] [CrossRef] [Google Scholar]
  8. Sullivan NJ, Geisbert TW, Geisbert JB, Xu L, Yang ZY, Roederer M, Koup RA, Jahrling PB, Nabel GJ. 2003. Accelerated vaccination for Ebola virus haemorrhagic fever in non-human primates. Nature 424:681–684. doi:10.1038/nature01876. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  9. Tapia MD, Sow SO, Lyke KE, Haidara FC, Diallo F, Doumbia M, Traore A, Coulibaly F, Kodio M, Onwuchekwa U, Sztein MB, Wahid R, Campbell JD, Kieny MP, Moorthy V, Imoukhuede EB, Rampling T, Roman F, De Ryck R, Bellamy IAR, Dally L, Mbaya OT, Ploquin A, Zhou Y, Stanley DA, Bailer R, Koup RA, Roederer M, Ledgerwood J, Hill AV, Ballou WR, Sullivan N, Graham B, Levine MM. 2016. Use of ChAd3-EBO-Z Ebola virus vaccine in Malian and US adults, and boosting of Malian adults with MVA-BN-Filo: a phase 1, single-blind, randomised trial, a phase 1b, open-label and double-blind, dose-escalation trial, and a nested, randomised, double-blind, placebo-controlled trial. Lancet Infect Dis 16:31–42. doi:10.1016/S1473-3099(15)00362-X. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  10. Warfield KL, Aman MJ. 2011. Advances in virus-like particle vaccines for filoviruses. J Infect Dis 204(Suppl 3):S1053–S1059. doi:10.1093/infdis/jir346. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  11. Warfield KL, Swenson DL, Olinger GG, Kalina WV, Aman MJ, Bavari S. 2007. Ebola virus-like particle-based vaccine protects nonhuman primates against lethal Ebola virus challenge. J Infect Dis 196(Suppl 2):S430–S437. doi:10.1086/520583. [PubMed] [CrossRef] [Google Scholar]
  12. Bavari S, Bosio CM, Wiegand E, Ruthel G, Will AB, Geisbert TW, Hevey M, Schmaljohn C, Schmaljohn A, Aman MJ. 2002. Lipid raft microdomains: a gateway for compartmentalized trafficking of Ebola and Marburg viruses. J Exp Med 195:593–602. doi:10.1084/jem.20011500. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  13. Harty RN, Brown ME, Wang G, Huibregtse J, Hayes FP. 2000. A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: implications for filovirus budding. Proc Natl Acad Sci U S A 97:13871–13876. doi:10.1073/pnas.250277297. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  14. Jasenosky LD, Neumann G, Lukashevich I, Kawaoka Y. 2001. Ebola virus VP40-induced particle formation and association with the lipid bilayer. J Virol 75:5205–5214. doi:10.1128/JVI.75.11.5205-5214.2001. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  15. Noda T, Sagara H, Suzuki E, Takada A, Kida H, Kawaoka Y. 2002. Ebola virus VP40 drives the formation of virus-like filamentous particles along with GP. J Virol 76:4855–4865. doi:10.1128/JVI.76.10.4855-4865.2002. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  16. Falzarano D, Geisbert TW, Feldmann H. 2011. Progress in filovirus vaccine development: evaluating the potential for clinical use. Expert Rev Vaccines 10:63–77. doi:10.1586/erv.10.152. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  17. Sullivan NJ, Martin JE, Graham BS, Nabel GJ. 2009. Correlates of protective immunity for Ebola vaccines: implications for regulatory approval by the animal rule. Nat Rev Microbiol 7:393–400. doi:10.1038/nrmicro2129. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  18. Kallstrom G, Warfield KL, Swenson DL, Mort S, Panchal RG, Ruthel G, Bavari S, Aman MJ. 2005. Analysis of Ebola virus and VLP release using an immunocapture assay. J Virol Methods 127:1–9. doi:10.1016/j.jviromet.2005.02.015. [PubMed] [CrossRef] [Google Scholar]
  19. Licata JM, Johnson RF, Han Z, Harty RN. 2004. Contribution of ebola virus glycoprotein, nucleoprotein, and VP24 to budding of VP40 virus-like particles. J Virol 78:7344–7351. doi:10.1128/JVI.78.14.7344-7351.2004. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  20. Mayr A, Stickl H, Müller HK, Danner K, Singer H. 1978. The smallpox vaccination strain MVA: marker, genetic structure, experience gained with the parenteral vaccination and behavior in organisms with a debilitated defence mechanism. Zentralbl Bakteriol B 167:375–390. [PubMed] [Google Scholar]
  21. Suter M, Meisinger-Henschel C, Tzatzaris M, Hülsemann V, Lukassen S, Wulff NH, Hausmann J, Howley P, Chaplin P. 2009. Modified vaccinia Ankara strains with identical coding sequences actually represent complex mixtures of viruses that determine the biological properties of each strain. Vaccine 27:7442–7450. doi:10.1016/j.vaccine.2009.05.095. [PubMed] [CrossRef] [Google Scholar]
  22. Gomez CE, Najera JL, Krupa M, Perdiguero B, Esteban M. 2011. MVA and NYVAC as vaccines against emergent infectious diseases and cancer. Curr Gene Ther 11:189–217. doi:10.2174/156652311795684731. [PubMed] [CrossRef] [Google Scholar]
  23. Sutter G, Staib C. 2003. Vaccinia vectors as candidate vaccines: the development of modified vaccinia virus Ankara for antigen delivery. Curr Drug Targets Infect Disord 3:263–271. doi:10.2174/1568005033481123. [PubMed] [CrossRef] [Google Scholar]
  24. Chakrabarti S, Sisler JR, Moss B. 1997. Compact, synthetic, vaccinia virus early/late promoter for protein expression. Biotechniques 23:1094–1097. [PubMed] [Google Scholar]
  25. Wennier ST, Brinkmann K, Steinhäußer C, Mayländer N, Mnich C, Wielert U, Dirmeier U, Hausmann J, Chaplin P, Steigerwald R. 2013. A novel naturally occurring tandem promoter in modified vaccinia virus Ankara drives very early gene expression and potent immune responses. PLoS One 8:e73511. doi:10.1371/journal.pone.0073511. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  26. Jeffers SA, Sanders DA, Sanchez A. 2002. Covalent modifications of the ebola virus glycoprotein. J Virol 76:12463–12472. doi:10.1128/JVI.76.24.12463-12472.2002. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  27. Volchkov VE, Feldmann H, Volchkova VA, Klenk HD. 1998. Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci U S A 95:5762–5767. doi:10.1073/pnas.95.10.5762. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  28. Volchkov VE, Volchkova VA, Slenczka W, Klenk HD, Feldmann H. 1998. Release of viral glycoproteins during Ebola virus infection. Virology 245:110–119. doi:10.1006/viro.1998.9143. [PubMed] [CrossRef] [Google Scholar]
  29. Noda T, Watanabe S, Sagara H, Kawaoka Y. 2007. Mapping of the VP40-binding regions of the nucleoprotein of Ebola virus. J Virol 81:3554–3562. doi:10.1128/JVI.02183-06. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  30. McCarthy SE, Johnson RF, Zhang YA, Sunyer JO, Harty RN. 2007. Role for amino acids 212KLR214 of Ebola virus VP40 in assembly and budding. J Virol 81:11452–11460. doi:10.1128/JVI.00853-07. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  31. Ward BM, Moss B. 2000. Golgi network targeting and plasma membrane internalization signals in vaccinia virus B5R envelope protein. J Virol 74:3771–3780. doi:10.1128/JVI.74.8.3771-3780.2000. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  32. Spurgers KB, Alefantis T, Peyser BD, Ruthel GT, Bergeron AA, Costantino JA, Enterlein S, Kota KP, Boltz RC, Aman MJ, Delvecchio VG, Bavari S. 2010. Identification of essential filovirion-associated host factors by serial proteomic analysis and RNAi screen. Mol Cell Proteomics 9:2690–2703. doi:10.1074/mcp.M110.003418. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  33. Yasuda J, Nakao M, Kawaoka Y, Shida H. 2003. Nedd4 regulates egress of Ebola virus-like particles from host cells. J Virol 77:9987–9992. doi:10.1128/JVI.77.18.9987-9992.2003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  34. Johnson RF, Bell P, Harty RN. 2006. Effect of Ebola virus proteins GP, NP and VP35 on VP40 VLP morphology. Virol J 3:31. doi:10.1186/1743-422X-3-31. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  35. Noda T, Ebihara H, Muramoto Y, Fujii K, Takada A, Sagara H, Kim JH, Kida H, Feldmann H, Kawaoka Y. 2006. Assembly and budding of Ebolavirus. PLoS Pathog 2:e99. doi:10.1371/journal.ppat.0020099. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  36. Spehner D, Drillien R. 2008. Extracellular vesicles containing virus-encoded membrane proteins are a byproduct of infection with modified vaccinia virus Ankara. Virus Res 137:129–136. doi:10.1016/j.virusres.2008.07.003. [PubMed] [CrossRef] [Google Scholar]
  37. Kushnir N, Streatfield SJ, Yusibov V. 2012. Virus-like particles as a highly efficient vaccine platform: diversity of targets and production systems and advances in clinical development. Vaccine 31:58–83. doi:10.1016/j.vaccine.2012.10.083. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  38. Swenson DL, Warfield KL, Larsen T, Alves DA, Coberley SS, Bavari S. 2008. Monovalent virus-like particle vaccine protects guinea pigs and nonhuman primates against infection with multiple Marburg viruses. Expert Rev Vaccines 7:417–429. doi:10.1586/14760584.7.4.417. [PubMed] [CrossRef] [Google Scholar]
  39. Warfield KL, Bosio CM, Welcher BC, Deal EM, Mohamadzadeh M, Schmaljohn A, Aman MJ, Bavari S. 2003. Ebola virus-like particles protect from lethal Ebola virus infection. Proc Natl Acad Sci U S A 100:15889–15894. doi:10.1073/pnas.2237038100. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  40. Warfield KL, Swenson DL, Negley DL, Schmaljohn AL, Aman MJ, Bavari S. 2004. Marburg virus-like particles protect guinea pigs from lethal Marburg virus infection. Vaccine 22:3495–3502. doi:10.1016/j.vaccine.2004.01.063. [PubMed] [CrossRef] [Google Scholar]
  41. Warfield KL, Dye JM, Wells JB, Unfer RC, Holtsberg FW, Shulenin S, Vu H, Swenson DL, Bavari S, Aman MJ. 2015. Homologous and heterologous protection of nonhuman primates by Ebola and Sudan virus-like particles. PLoS One 10:e0118881. doi:10.1371/journal.pone.0118881. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  42. Sänger C, Mühlberger E, Klenk HD, Becker S. 2001. Adverse effects of MVA-T7 on the transport of Marburg virus glycoprotein. J Virol Methods 91:29–35. doi:10.1016/S0166-0934(00)00239-1. [PubMed] [CrossRef] [Google Scholar]
  43. Gregory DA, Olinger GY, Lucas TM, Johnson MC. 2014. Diverse viral glycoproteins as well as CD4 co-package into the same human immunodeficiency virus (HIV-1) particles. Retrovirology 11:28. doi:10.1186/1742-4690-11-28. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  44. Blasco R, Moss B. 1992. Role of cell-associated enveloped vaccinia virus in cell-to-cell spread. J Virol 66:4170–4179. [PMC free article] [PubMed] [Google Scholar]
  45. Smith GL, Law M. 2004. The exit of vaccinia virus from infected cells. Virus Res 106:189–197. doi:10.1016/j.virusres.2004.08.015. [PubMed] [CrossRef] [Google Scholar]
  46. Becker S, Rinne C, Hofsäss U, Klenk HD, Mühlberger E. 1998. Interactions of Marburg virus nucleocapsid proteins. Virology 249:406–417. doi:10.1006/viro.1998.9328. [PubMed] [CrossRef] [Google Scholar]
  47. Björndal AS, Szekely L, Elgh F. 2003. Ebola virus infection inversely correlates with the overall expression levels of promyelocytic leukaemia (PML) protein in cultured cells. BMC Microbiol 3:6. doi:10.1186/1471-2180-3-6. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  48. Hoenen T, Biedenkopf N, Zielecki F, Jung S, Groseth A, Feldmann H, Becker S. 2010. Oligomerization of Ebola virus VP40 is essential for particle morphogenesis and regulation of viral transcription. J Virol 84:7053–7063. doi:10.1128/JVI.00737-10. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  49. Swenson DL, Warfield KL, Negley DL, Schmaljohn A, Aman MJ, Bavari S. 2005. Virus-like particles exhibit potential as a pan-filovirus vaccine for both Ebola and Marburg viral infections. Vaccine 23:3033–3042. doi:10.1016/j.vaccine.2004.11.070. [PubMed] [CrossRef] [Google Scholar]
  50. Hoenen T, Volchkov V, Kolesnikova L, Mittler E, Timmins J, Ottmann M, Reynard O, Becker S, Weissenhorn W. 2005. VP40 octamers are essential for Ebola virus replication. J Virol 79:1898–1905. doi:10.1128/JVI.79.3.1898-1905.2005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  51. Panchal RG, Ruthel G, Kenny TA, Kallstrom GH, Lane D, Badie SS, Li L, Bavari S, Aman MJ. 2003. In vivo oligomerization and raft localization of Ebola virus protein VP40 during vesicular budding. Proc Natl Acad Sci U S A 100:15936–15941. doi:10.1073/pnas.2533915100. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  52. Spiegelberg L, Wahl-Jensen V, Kolesnikova L, Feldmann H, Becker S, Hoenen T. 2011. Genus-specific recruitment of filovirus ribonucleoprotein complexes into budding particles. J Gen Virol 92:2900–2905. doi:10.1099/vir.0.036863-0. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  53. Marzi A, Engelmann F, Feldmann F, Haberthur K, Shupert WL, Brining D, Scott DP, Geisbert TW, Kawaoka Y, Katze MG, Feldmann H, Messaoudi I. 2013. Antibodies are necessary for rVSV/ZEBOV-GP-mediated protection against lethal Ebola virus challenge in nonhuman primates. Proc Natl Acad Sci U S A 110:1893–1898. doi:10.1073/pnas.1209591110. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  54. Qiu X, Fernando L, Melito PL, Audet J, Feldmann H, Kobinger G, Alimonti JB, Jones SM. 2012. Ebola GP-specific monoclonal antibodies protect mice and guinea pigs from lethal Ebola virus infection. PLoS Negl Trop Dis 6:e1575. doi:10.1371/journal.pntd.0001575. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  55. Kajihara M, Marzi A, Nakayama E, Noda T, Kuroda M, Manzoor R, Matsuno K, Feldmann H, Yoshida R, Kawaoka Y, Takada A. 2012. Inhibition of Marburg virus budding by nonneutralizing antibodies to the envelope glycoprotein. J Virol 86:13467–13474. doi:10.1128/JVI.01896-12. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  56. Baur K, Brinkmann K, Schweneker M, Pätzold J, Meisinger-Henschel C, Hermann J, Steigerwald R, Chaplin P, Suter M, Hausmann J. 2010. Immediate-early expression of a recombinant antigen by modified vaccinia virus Ankara breaks the immunodominance of strong vector-specific B8R antigen in acute and memory CD8 T-cell responses. J Virol 84:8743–8752. doi:10.1128/JVI.00604-10. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  57. Meisinger-Henschel C, Späth M, Lukassen S, Wolferstätter M, Kachelriess H, Baur K, Dirmeier U, Wagner M, Chaplin P, Suter M, Hausmann J. 2010. Introduction of the six major genomic deletions of modified vaccinia virus Ankara (MVA) into the parental vaccinia virus is not sufficient to reproduce an MVA-like phenotype in cell culture and in mice. J Virol 84:9907–9919. doi:10.1128/JVI.00756-10. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  58. Meisinger-Henschel C, Schmidt M, Lukassen S, Linke B, Krause L, Konietzny S, Goesmann A, Howley P, Chaplin P, Suter M, Hausmann J. 2007. Genomic sequence of chorioallantois vaccinia virus Ankara, the ancestor of modified vaccinia virus Ankara. J Gen Virol 88:3249–3259. doi:10.1099/vir.0.83156-0. [PubMed] [CrossRef] [Google Scholar]
  59. Falkner FG, Moss B. 1990. Transient dominant selection of recombinant vaccinia viruses. J Virol 64:3108–3111. [PMC free article] [PubMed] [Google Scholar]
  60. Kalhoro NH, Veits J, Rautenschlein S, Zimmer G. 2009. A recombinant vesicular stomatitis virus replicon vaccine protects chickens from highly pathogenic avian influenza virus (H7N1). Vaccine 27:1174–1183. doi:10.1016/j.vaccine.2008.12.019. [PubMed] [CrossRef] [Google Scholar]
  61. Hoffmann M, Wu YJ, Gerber M, Berger-Rentsch M, Heimrich B, Schwemmle M, Zimmer G. 2010. Fusion-active glycoprotein G mediates the cytotoxicity of vesicular stomatitis virus M mutants lacking host shut-off activity. J Gen Virol 91:2782–2793. doi:10.1099/vir.0.023978-0. [PubMed] [CrossRef] [Google Scholar]
  62. Schweneker M, Lukassen S, Späth M, Wolferstätter M, Babel E, Brinkmann K, Wielert U, Chaplin P, Suter M, Hausmann J. 2012. The vaccinia virus O1 protein is required for sustained activation of extracellular signal-regulated kinase 1/2 and promotes viral virulence. J Virol 86:2323–2336. doi:10.1128/JVI.06166-11. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  63. Wolferstätter M, Schweneker M, Späth M, Lukassen S, Klingenberg M, Brinkmann K, Wielert U, Lauterbach H, Hochrein H, Chaplin P, Suter M, Hausmann J. 2014. Recombinant modified vaccinia virus Ankara generating excess early double-stranded RNA transiently activates protein kinase R and triggers enhanced innate immune responses. J Virol 88:14396–14411. doi:10.1128/JVI.02082-14. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  64. Meier AF, Laimbacher AS, Ackermann M. 2016. Polycistronic herpesvirus amplicon vectors for veterinary vaccine development. Methods Mol Biol 1349:201–224. doi:10.1007/978-1-4939-3008-1_13. [PubMed] [CrossRef] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

Ebola antigens

Leave a comment

All comments are moderated before being published