Novel Strategy To Adapt Simian-Human Immunodeficiency Virus E1 Carrying env from an RV144 Volunteer to Rhesus Macaques: Coreceptor Switch and Final Recovery of a Pathogenic Virus with Exclusive R5 Tropism.

FIG 10

Predicted amino acid changes in the V3 loop of HIV clade E gp120 associated with coreceptor switching. (A) Alignment of V3 loop amino acid sequences of either infectious molecular clones (IMCs) or biological SHIV isolates (designated virus¹) with the consensus CRF01_AE sequence (46) and the parental SHIV-E1 IMC. env clones had been inserted into NL-LucR vectors and were shown to be infectious; env clones had been isolated on day 14 or 57 from passage 2. The sequence of SHIV-E1p2d14c183, a clone that was used for subsequent readaptation, is also listed. Sequences starting with EU and GU were derived from data reported previously and are designated reference (Ref) clones (46, 70). A red box indicates V3 loop sequences associated with R5 tropism, and a blue box indicates sequences associated with dual tropism or X4 usage. The tropism was predicted by the PhenoSeq platform (22). (B) SHIV-E1 phylogenetic tree. Env amino acid sequences of the SHIV-E1 parental IMC and SHIV-E1 isolates were aligned and analyzed for evolutionary relatedness in Mega7. The branch lengths reflect the number of substitutions per site. Red boxes indicate R5 viruses, and blue boxes indicate R5X4/X4 viruses.

The V3 loop amino acid sequence predicted to be associated with R5 tropism, TRT at positions 304 to 306, was identical in all IMCs and viral isolates that were exclusively R5 tropic by coreceptor usage assays (Fig. 10A, red box). In contrast, all IMCs encoding env from passage 2 at day 57 had the sequence IRI at these positions, while the SHIV-E1p2d57 isolate had this same sequence at a prevalence of ∼80% (Fig. 9 and ​and10).10). These IMCs and this virus strain were predicted to have X4-tropic phenotypes by PhenoSeq. However, with the exception of NL-LucR.E1p2d57c32, they were all found to be dual tropic in coreceptor usage assays. Notably, a third mutation seen in V3 of SHIV-E1p2d57 at an ∼20% prevalence, I323M, was present in X4-tropic NL-LucR.E1p2d57c32. Essentially, data from the deep-sequencing analysis shown in Fig. 9 were confirmed by conventional sequencing of infectious env clones in Fig. 10A. While we were initially concerned that deep sequencing may include sequence information from nonfunctional, noninfectious env sequences, both data sets yielded similar results.

We observed additional amino acid changes in regions outside V3 in SHIV-E1p2d57 Env compared to the parental IMC and all other R5 isolates (Fig. 9, third panel). These changes include mutations in the V2 loop, the C3 and C4 regions, and gp41. Interestingly, a mutation was found at amino acid position 426, which lies within the CD4-induced (CD4i) epitope, a region known for CCR5 binding (23, 24). This G426R mutation was present at a low frequency in the earlier SHIV-E1p1d203 and SHIV-E1p2d57 isolates but was highly prevalent in the dual-tropic isolate. The final R5 SHIV-E1p5 isolate did not contain this mutation.

A striking difference in amino acid mutations at the gp41 C terminus was noted. Three mutations became fixed in SHIV-E1p1d203 and SHIV-E1p5 at amino acid positions 790, 849, and 853 but were completely absent in the dual-tropic isolate SHIV-E1p2d57, implying that the latter arose directly from an archival clone that had not yet mutated at these three gp41 positions. The remarkable absence of amino acid variability in the C terminus of gp41 in SHIV-E1p2d57 prompted us to perform a phylogenetic tree analysis (Fig. 10B). Indeed, this analysis confirmed that the dual-tropic env isolate arose directly from parental SHIV-E1 rather than from intermediary R5-tropic progeny, such as the isolate taken from the same RM at an earlier time point, SHIV-E1p2d14. These data indicate that the original E1 envelope has the ability to undergo a coreceptor switch. Interestingly, SHIV-E1p1d203 was more closely related to SHIV-E1p5 than isolates from the second passage. This could be due to the fact that SHIV-E1p1d203 replicated for a significantly longer period of time in the first animal (203 days) than did SHIV-E1p2d14 in the first and second RMs combined (67 days), as mentioned above. Another possibility is that the recovery of CD8⁺ T cells may have caused mutations similar to those observed in SHIV-E1p5. We had stopped depleting CD8⁺ and B cells in animal R547 on day 100, and by day 203, recovery of CD8⁺ cells could have exerted selective pressure. In contrast, neutralizing antibody responses are unlikely to arise within such a short time. To summarize, the change in tropism involved not only the V3 loop but also changes in other parts of the envelope.

Go to:

DISCUSSION

Here we report the successful construction, adaptation, and characterization of SHIV-E that carries an HIV CRF01_AE envelope isolated from a volunteer in the RV144 trial who had been given placebo. Our newly isolated virus, SHIV-E1p5, recapitulates key biological aspects of HIV CRF01_AE transmission in humans. SHIV-E1p5, an exclusively R5-tropic virus with a tier 2 neutralization phenotype, was mucosally transmissible, replicated robustly in RMs, and caused a severe depletion of CD4⁺ T cells, leading to AIDS. During the initial adaptation phase, the newly created SHIV also underwent a coreceptor switch to dual or X4 tropism. Deep sequencing revealed that dual/X4-tropic virus branched off very early during its evolution, starting from the parental SHIV-E1 construct.

We had to overcome severe host restriction: the initial parental SHIV-E1 construct replicated well in human cells but failed to grow in any rhesus PBMC cultures from multiple donors. Other investigators also reported that newly constructed SHIVs replicate inefficiently in rhesus PBMC (25, 26). We devised a novel strategy: in vivo transfection by i.m. inoculation of infectious proviral DNA and repeated administration of cell-free virus under ablation of both arms of adaptive immunity. This was achieved by the depletion of CD8⁺ T cells and NK cells by an anti-CD8 mAb and of B cells by an anti-CD20 mAb, respectively. This combined approach resulted in high levels of sustained viremia that led to severe losses of CD4⁺ T cells. Of note, all virus passages were designed to circumvent the pressure of neutralizing antibodies to prevent the selection of neutralization escape viral variants. An additional benefit of B-cell depletion was the prevention of RM antibody responses to the anti-CD8 mAb, which allowed us to give this mAb repeatedly, thereby extending the time window of CD8 depletion to several weeks.

Intramuscular inoculation of SIV proviral plasmid DNA has been used previously (27, 28) and resulted in sustained viremia and disease progression. Subsequently, i.m. DNA inoculation was used to vaccinate animals with nef-deleted, live attenuated SIV (29, 30). To our knowledge, the use of in vivo i.m. transfection to jump-start SHIV replication in a new host species, where none of the PBMC cultures have previously supported virus replication, has not been attempted previously. Virions budding from transfected RM muscle cells acquire host cell membranes into which HIV clade E Env spikes are embedded together with other host molecules. Possibly, such particles are more likely to enter RM target cells to increase the intensity of virus replication in subsequent cycles. Given that our goal was to expeditiously generate a RM replication-competent, pathogenic SHIV-E strain for use in preclinical vaccine trials, the individual contributions of i.m. inoculation with infectious proviral DNA and repeated i.v. inoculations of cell-free virus to the overall success in achieving high replication levels in the first animal are unknown because they were carried out simultaneously. We can say with certainty, however, that removing host defenses allowed unbridled viral replication. Overall, our combined strategy of proviral DNA inoculation, repeated inoculations with virus produced in transfected 293T cells, and sustained ablation of host adaptive immune responses led to the rapid adaptation of the new virus.

In retrospect, the second recipient, animal R551, initially had clinically silent T. cruzi infection. Due to the double immunodepletion with anti-CD8 and anti-CD20 mAbs and the resulting high levels of SHIV viremia that depleted CD4⁺ T cells, RM R551 had severe immunodeficiency, which led to parasitemia detectable by microscopy. This came as a surprise; after all, the primate study was conducted in Maryland. It turned out that this animal came from a breeding facility in southern Texas, where the arthropod vectors for T. cruzi, Triatoma species or “kissing bugs,” are widespread. A recent survey across Texas revealed that ∼50% of these vectors, including those found near human dwellings, harbor T. cruzi (31). When a baboon colony housed outdoors at the Southwest National Primate Research Center was examined for T. cruzi, 57% of the animals tested were seropositive, and among these, 24% had echocardiographic evidence of Chagas' heart disease (32, 33). In the context of HIV infection, T. cruzi is considered to be an opportunistic infection, and there is evidence that the two pathogens mutually upregulate each other (13, 34,–36). A recent epidemiological survey in Brazil found a 5% coinfection prevalence in HIV-positive individuals, 3.8 times higher than previously estimated (37).

We previously showed that preexisting parasite infection in RMs increased the risk of R5 SHIV acquisition as well as peak viremia (38). Similarly, parasite inoculation of RMs with chronic SHIV infection exacerbated viremia (39). However, to our knowledge, an association of parasite coinfection and HIV Env coreceptor switching has not been reported. To date, the exact mechanisms driving HIV Env coreceptor switching remain to be determined.

Cheng-Mayer et al. previously reported HIV Env coreceptor switching in the context of SHIV infection in RMs (40,–43). Their work involved SHIV_SF162P3N, a late-stage, R5 clade B SHIV. An X4 strain, SHIV_BR24N, was recovered at necropsy, at 28 weeks postinoculation, from the SHIV_SF162P3N-infected RM (41). When comparing the evolutionary changes during coreceptor switching in the clade B SHIV to our case, common mutations were noted, as follows: T to I in V3 (T304I in SHIV-E1p2d57) and two mutations in C4 (next to G426R in SHIV-E1p2d57). The C4 changes are within a conserved region previously shown to be involved in binding to HIV coreceptors (44, 45). The shared T-to-I change in V3 is predicted to cause the loss of a potential N-linked glycosylation site, which has been linked to X4 usage in the case of HIV CRF01_AE Envs (46). Other amino acid changes in SHIV_BR24N Env were not shared in our case. Phylogenetic tree analysis showed that X4 SHIV_BR24N variants branched off late in the disease course from one of two R5 SHIV_SF162P3N clusters. In contrast, the coreceptor switch that we observed arose independently from the parental IMC construct as a separate branch.

Env sequences and the evolution of viral variants from an earlier time point, week 20 after inoculation of the SHIV_SF162P3N-infected RM, were also determined; such viruses were R5X4 intermediates between the initial R5 SHIV and the final X4 variant (43). In our case, we observed the emergence of a minor fraction of X4-only virus at necropsy; most SHIV-E1p2d57 variants were dual tropic.

The Cheng-Mayer group reported a second case of coreceptor switching in a SHIV_SF162P3N-infected, CD8-depleted RM (42). Replacing only the V3 loop in the R5 parental strain with that of an X4-only isolate revealed that V3 mutations were necessary for the coreceptor switch, but additional changes present in V1/V2, C4, and gp41 in the X4 isolate yielded optimal virus entry into indicator cell lines. V3 loop mutations in this second case of SHIV_SF162P3N coreceptor switching differed from those in the first case, indicating convergent evolution. The Cheng-Mayer group then documented molecular evolution resulting in the coreceptor switch of a clade B SHIV; our data expand these findings to a clade E SHIV. Clearly, HIV envelopes of different clades have the capacity to alter coreceptor use in the context of SHIV infection in RMs, akin to different HIV clades in humans.

Studying molecular envelope evolution by deep sequencing revealed some striking patterns. Compared to the parental construct SHIV-E1, all three R5-only isolates contained 12 amino acid changes in Env that had become fixed with a prevalence of 90 to 100%, indicating a selective advantage of R5 progeny viruses (Fig. 9). Since they were present in the early isolate, SHIV-E1p2d14, host immune responses played no part in the selection of these mutations. Of note, only 3 of these 12 amino acid changes were found at such a high prevalence in the dual-tropic isolate, SHIV-E1p2d57, thus confirming early divergence during evolution between the R5- and dual-tropic progeny. Overall, the predicted amino acid sequence conservation in the R5-only strains ranges between 98 and 99% compared to the parental envelope.

The last viral isolate, SHIV-E1p5, is the only one that had been exposed to the selective pressures of innate and adaptive host immunity, predominantly cell-mediated immune responses. The virus replicated in animal R798 (passage 4) for 28 days until blood transfer to the last recipient, R974, the source of SHIV-E1p5 isolated on day 42. Neither of these last two recipients were immunodepleted. Thus, within 28 or 42 days, cell-mediated immune responses may have selected cytotoxic-T-lymphocyte (CTL) escape mutants in SHIV-E1p5 (47). In contrast, neutralizing antibodies typically take months to develop, especially against viruses with a tier 2 neutralization phenotype. Of note, anti-V3 loop neutralizing antibodies develop early. The lack of new mutations in the SHIV-E1p5 V3 loop is an indirect sign that neutralizing antibodies had not yet developed within the short replication times allowed in the fourth and fifth recipients.

Recently, the generation of SHIV challenge stocks carrying HIV CRF01_AE env (26) was described. Our stock, SHIV-E1p5, differs in important ways. (i) env carried by SHIV-E1p5 was derived from the RV144 placebo group. As such, our SHIV provides a link to this phase III trial with a contemporaneous env. The env genes used by Tartaglia et al. were from RV217 and R254, both focused on early HIV transmission. (ii) Tartaglia et al. monitored SHIV-infected RMs maximally for only 10 to 20 weeks, during which time no significant pathogenicity was observed. (iii) Two of the three challenge stocks described by Tartaglia et al. were prepared in human PBMC. This raises important issues for preclinical vaccine efficacy trials. Repeated low-dose mucosal challenges of RMs with human PBMC-grown viruses can generate xenoresponses, which differ from alloresponses during human-to-human transmission of HIV. If candidate vaccines are also produced in human cells, human cell-grown challenge SHIV or SIV stocks are contraindicated for efficacy studies in macaques, based upon data reported previously (48,–50). (iv) The LTR in our SHIV-E1p5 is more akin to HIV LTRs that have extra NF-κB sites. In contrast, the SIVmac239 LTR has only one such site. Higher numbers of NF-κB sites are known to be more responsive to cytokine stimulation for activation signals using the NF-κB signal transduction pathway (10, 51). This may be important for studies aimed at studying virus reservoirs and eradication.

The final virus stock, SHIV-E1p5, is a biological isolate that can be used as a tool to assess prevention strategies targeted against CRF01_AE in NHPs. Preclinical vaccine efficacy studies frequently use repeated low-dose mucosal challenges. While we have been able to give a proof of concept that SHIV-E1p5 is mucosally transmissible, the limitations of our studies allowed us to enroll only one animal to test the i.r. route using a high-dose inoculum. Further studies will be required to assess repeated low-dose challenges, including other mucosal routes. The use of biological SHIV isolates in place of IMCs more accurately reflects HIV transmission among humans, where multiple quasispecies are present at each exposure. However, regarding the SHIV/RM model, one of the limitations of using a biological SHIV isolate for challenges is that virus features, such as neutralization phenotype and pathogenicity, may not be properties of all viral variants in the inoculum. As a result, the clinical outcomes in individual RM hosts with breakthrough infection may vary in situations involving low-dose challenges with the transmission of only one or a few variants. However, challenges with a biological isolate also provide the experimental advantage of indicating how many quasispecies are transmitted when testing vaccine efficacy.

In summary, SHIV-E1p5, a RM PBMC-grown strain, reflects key biological aspects of HIV transmission and disease progression in humans. As such, this virus represents a tool to evaluate anti-HIV CRF01_AE prevention strategies by passive and/or active immunization of rhesus macaques.

Go to:

MATERIALS AND METHODS

Construction of infectious proviruses and generation of virus stocks.

Infectious HIV CRF01_AE env clones derived from placebo group participants in the RV144 phase III vaccine trial in Thailand (1) were used to generate several proviral SHIV-E clones. One of the env clones, 620345.2, was engineered to incorporate KpnI and BamHI restriction sites into the env sequence by PCR using primers Fwd-620345-Kpn (ST-A101; AGTTTATTATGGGGTACCTGTGTGGAGAGATGCAGA) and Rev-620345-Bam (ST-A102; CAGGCAAGTGCTAAGGATCCGCTCACTAATCG). The addition of these sites enabled the cloning of the env sequence into the SHIV-1157ipd3N4 backbone (GenBank accession no. DQ779174) (10). Clones with the correct env insert were identified by restriction enzyme digestion and confirmed by sequencing (Genewiz Inc.). The final construct, termed SHIV-620345.2, or SHIV-E1 for short, was transfected into 293T cells by using FuGENE6 transfection reagent (Promega), and supernatants were filtered to produce the SHIV-E1 stock.

To generate the NL-Luc.R version of passage 2 virus, termed SHIV-E1p2, the envelope region of the latter was cloned into the proviral DNA backbone of pNL-LucR.T2A (16). The backbone region of pBR322 (New England BioLabs) and the env region of pNL-LucR.T2A were excised by using the EcoRI/BamHI restriction sites and ligated to produce the shuttle vector pBR322(NL4-3). The env region of SHIV-E1p2 was excised by using the KpnI/BamHI restriction sites and cloned into the backbone of the shuttle vector pBR322(NL4-3). Finally, using the EcoRI/BamHI restriction sites, the env region of pBR322-NL-E1 was swapped into the backbone of pNL-LucR.T2A to obtain NL-LucR.E1. The final construct was confirmed by PCR and DNA digestion.

To generate an infectious molecular clone of SHIV-E1p2, the env regions of NL-LucR.E1 and the 3′ half of the infectious provirus clone SHIV-1157ipd3N4, termed 3′ SHIV-1157ipd3N4, were swapped by digestion with KpnI and BamHI followed by ligation to produce 3′ SHIV-E1; the resulting plasmid was confirmed by PCR. Finally, env of 3′ SHIV-E1 and the backbone of 5′ SHIV-vpu⁺ were digested with SphI and NotI and ligated to produce the final SHIV-E1p2 IMC, termed SHIV-E1p2c183. The final construct was confirmed by PCR and restriction enzyme digestion, and the env sequence was confirmed by DNA sequencing. SHIV-E1p2c183 was transfected into 293T cells by using X-tremeGENE 9 DNA transfection reagent (Sigma) to produce the SHIV-E1p2c183 stock.

Virus controls.

Several virus controls were used for various in vitro assays. SHIV-1157ipd3N4 (clade C) (10) and SHIV-KNH1144p4 (clade A) (our unpublished data) were developed in our laboratory. HIV-1_NL4-3 and HIV-1_96USSN20 (52) were obtained from the NIH AIDS Reagent Program. HIV1084i is an IMC of a recently transmitted clade C virus isolated from a Zambian infant (53).

Cells and cell culture.

CEMx174-GFP cells (gift of Barbara Felber, National Cancer Institute, Frederick, MD) contain the green fluorescent protein (GFP) gene under the regulation of the HIV LTR and express CD4 and CXCR4. CEMx174-GFP cells were grown in RPMI 1640 supplemented with 25 mM HEPES, 2 mM l-glutamine, 100 U/ml penicillin-streptomycin (Gibco), and 10% fetal bovine serum (FBS) (SAFC Bioscience). U87 and GHOST(3) cells express either only human CD4 or CD4 along with various HIV/SIV human chemokine coreceptors. U87 cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Gibco) supplemented with 15% FBS, 2 mM l-glutamine, 1 μg/ml puromycin (Sigma-Aldrich), 300 μg/ml Geneticin (G418 sulfate; Gibco), and 100 U/ml penicillin-streptomycin. GHOST(3) cells were grown in DMEM supplemented with 10% FBS, 500 μg/ml Geneticin (G418 sulfate), 100 μg/ml hygromycin (Gibco), 100 U/ml penicillin-streptomycin, and 1 μg/ml puromycin. TZM-bl cells (also designated JC53-bl [clone 13] cells) are derived from a HeLa cell line (JC.53) that stably expresses CD4 and CCR5; these cells also contain integrated reporter genes that express firefly luciferase or β-galactosidase under the control of the HIV LTR (54,–58). TZM-bl cells were grown in DMEM supplemented with 10% FBS, 25 mM HEPES, and 50 μg/ml gentamicin (Gibco). 293T cells were grown in DMEM supplemented with 10% FBS, 2 mM l-glutamine, and 100 U/ml penicillin-streptomycin. All Gibco cell culture reagents were purchased from Thermo Fisher Scientific. U87, GHOST, TZM-bl, and 293T cells were obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH. RM blood for PBMC isolation and virus stock generation was obtained from the Yerkes National Primate Research Center Comparative AIDS Core (Atlanta, GA) and the Southwest National Primate Research Center (San Antonio, TX). Human PBMC were isolated from heparinized blood of three anonymous healthy donors.

Antigen capture assays for p24 and p27.

Levels of p27 (SHIV, which carries SIV gag) and p24 (HIV) were determined by using the respective antigen capture enzyme-linked immunosorbent assay (ELISA) kits (ABL Inc.). Briefly, virus samples were mixed with disruption buffer to inactivate the virus and release p27/p24. Standards and inactivated virus samples were added to 96-well microELISA plates coated with murine mAbs against p27/p24; the assays were performed according to the manufacturer's instructions.

TCID₅₀ determination.

Virus samples were added to TZM-bl cells at serial 5-fold dilutions in medium prepared with DEAE-dextran (MP Biomedicals) at a final concentration of 15 μg/ml. The level of luciferase activity expressed in infected cells was measured at 48 h postinfection after adding the Bright-Glo luciferase substrate (Promega); plates were read in a Mithras LB 940 microplate reader (Berthold Technologies). The TCID₅₀ was calculated as the dilution point at which 50% of the cell cultures were infected, using a Microsoft Excel macro.

Neutralization sensitivity and tier phenotyping.

The neutralization sensitivity of SHIV-E1p5 was tested against a panel of nmAbs and neutralizing serum or plasma pools on TZM-bl cells, as described previously (59). Briefly, neutralizing antibody activity was measured in 96-well culture plates by using Tat-regulated luciferase (Luc) reporter gene expression to quantify reductions in virus infection in TZM-bl cells. Assays were performed with replication-competent SHIV stocks grown in human or RM PBMC. Serum/plasma samples for tier phenotyping were diluted over a range of 1:20 to 1:43,740 in cell culture medium, and purified polyclonal/monoclonal antibodies and sCD4 were assayed in concentrations ranging from 25 to 0.01 μg/ml, also diluted in cell culture medium. Test reagents were preincubated with virus (∼150,000 relative light unit equivalents) for 1 h at 37°C before the addition of cells. Following 48 h of incubation, cells were lysed, and Luc activity was determined by using a microtiter plate luminometer and BriteLite Plus reagent (PerkinElmer). Neutralization titers are the sample dilutions (for serum/plasma) or antibody concentrations (for sCD4, purified IgG preparations, and mAbs) at which relative luminescence units (RLU) were reduced by 50% compared to RLU in virus control wells after subtraction of background RLU in cell control wells. Serum/plasma samples were heat inactivated at 56°C for 1 h prior to assays. Neutralization tier phenotyping was conducted by measuring neutralization titers (50% infective dose [ID₅₀]values) as described above, using five to seven serum/plasma samples from HIV-positive (HIV⁺) individuals during chronic infection. The geometric mean titer (GMT) was calculated in Microsoft Excel, and the tier phenotype was determined by comparing these values to the GMTs of standard panels of viruses representing tier 1A, tier 1B, and tier 2 viruses (60, 61), using the same five or seven HIV⁺ serum/plasma samples.

Coreceptor usage assays.

CEMx174-GFP cells were exposed to various passages of SHIV-E1 for 48 to 72 h, and GFP expression was determined by using confocal microscopy (Nikon). HIV-1_NL4-3 and SHIV-1157ipd3N4 were used as X4- and R5-tropic controls, respectively. The U87 and GHOST(3) cell lines expressing human CD4 and HIV/SIV human coreceptors were used to study virus tropism. U87.CD4.CCR1, U87.CD4.CCR2, U87.CD4.CCR3, U87.CD4.CXCR4, U87.CD4.CCR5, GHOST(3) BOB/GPR15, and GHOST(3) Bonzo/STRL33 cells were plated at 1 × 10⁶ total cells per well, followed by the addition of predetermined amounts of virus p24/p27 in 200 μl to each well. Cells were washed in 1 ml of fresh medium the next day. Supernatants were collected starting on day 3 and then every other day for 2 weeks and analyzed by a p24/p27 ELISA. HIV-1_NL4-3, HIV1084i, and HIV-1_96USSN20 were used as X4, R5, and extended coreceptor usage controls, respectively.

Animals and animal care.

Seven Indian-origin RMs (Macaca mulatta) were used in this study; they were kept according to NIH guidelines on the care and use of laboratory animals at the NIH Simian Vaccine Evaluation Unit (SVEU) of Bioqual Inc., a USDA-registered facility accredited by the American Association for the Accreditation of Laboratory Animal Care International (AAALAC). Bioqual Inc. complies with all policies of the Guide for the Care and Use of Laboratory Animals (62); DHHS (NIH 85-23); Animal Welfare (DHHS-TN 73-2); NIH Manual Issuances 4206 and 6000-3-4-58; “Responsibility for Care and Use of Animals,” CDC/NIH, 4th ed.; “Biosafety in Microbiological and Biomedical Laboratories”; and Public Health Service Policy on Humane Care and Use of Laboratory Animals (63). The Animal Care and Use Committee at Bioqual Inc. approved all experiments and met all applicable federal and institutional standards. Animals were euthanized first by anesthetizing them with 0.6 ml ketamine and then by i.v. barbiturate overdose of 2.0 pentobarbital, at 1 ml/10 lb, which is consistent with the recommendations of the Panel on Euthanasia of the American Veterinary Medical Association.

Immunodepletion of B cells and CD8⁺ cells.

RMs R547 and R551 were immunodepleted of B cells and CD8⁺ cells by infusion of mAbs against CD20 and CD8, respectively. Anti-CD8 mAb (MT807R1; cM-T807 mAb with rhesus IgG1 constant and variable framework regions), obtained from the NIH Non-Human Primate Reagent Resource, was administered (50 mg/kg of body weight) at various intervals. B cells were depleted by using the anti-CD20 humanized mAb rituximab (Genentech Inc.), which was obtained through the Dana-Farber Cancer Institute Pharmacy and administered at a dose of 20 mg/kg of body weight. Animals receiving these mAbs were pretreated with diphenhydramine (1 mg/kg i.v.) to prevent possible reactions to the mAbs.

Plasma viral RNA measurement and cell counts.

The plasma viral RNA load was monitored weekly after each virus exposure. Plasma collected from virus-exposed RMs was clarified by centrifugation at 2,300 × g for 3 min and either lysed directly (0.1 ml) in lysis buffer (bioMérieux) or further centrifuged to pellet the virus from a higher volume (0.5 ml to 1 ml) by ultracentrifugation at 49,100 × g for 60 min. The virus pellet was then lysed in 1 ml lysis buffer. A fixed amount of Q calibrator RNA (10⁵ copies or 10⁴ copies) was added to the lysed sample, and the nucleic acid was extracted by using acidified silica, as described previously (64). Analysis of viral loads was performed by using two RNA assays with different primer-probe sets and different levels of sensitivity. The viral RNA load was quantitated by using a real-time nucleic acid sequence-based amplification assay (NASBA) for SIV RNA, as described previously (65). Samples showing undetectable RNA loads were further analyzed by using a second assay, which detects the presence of viral RNA only qualitatively, with a limit of detection of ∼25 copies of RNA. The amplification conditions for the qualitative assay used were similar to those used for the quantitative assay except that the amplification oligonucleotides used for wild-type RNA were AATTCTAATACGACTCACTATAGGGAAAGGTTATACATTCTGACACATT (P1) and AGGATCAGATATTGCAGGAA (P2). The SIV wild-type beacon (5′-FAM [6-carboxyfluorescein]-CGCGATAACCCCATACCAGTAGGCAACAATCGCG-IABkFQ-3) had a fluorophore (FAM) linked to the 5′ end and a quencher (Iowa black) at the 3′ end. Animals with undetectable viral RNA as determined by both quantitative and qualitative assays were considered uninfected.

Following challenge, RMs were bled periodically, and absolute CD4⁺ T-cell measurements were performed by using the BD Biosciences TruCount platform. This method was used to quantify absolute counts and percentages of subpopulations of CD3⁺ CD4⁺ T cells, CD3⁺ CD8⁺ T cells, and total CD45⁺ leukocytes. For fluorescence-activated cell sorter (FACS) analysis, a minimum of 5,000 CD45⁺ leukocytes were acquired. Multicheck low-positive-control (stabilized human blood) samples yielded results consistent with expected values.

Virus reisolation and expansion.

The different passages of SHIV-E1 were isolated from infected animals by PBMC cocultures, as described previously (10). Briefly, RM PBMC, including cells from prescreened naive RM donors, were isolated by using Ficoll-Paque Plus (GE Healthcare Life Sciences); PBMC from naive donors were stimulated separately with 7 μg/ml concanavalin A (ConA) (Sigma-Aldrich) for 3 days and 40 U/ml of human interleukin-2 (IL-2) (Sigma-Aldrich) for 2 days prior to mixing them at a ratio of 1:1 with the PBMC from infected animals. Cocultures were maintained in medium with 10 ng/ml human TNF-α (10) and 40 U/ml of human IL-2. Supernatants were collected, every 48 to 72 h, with medium replacements at every collection, for >3 weeks, and filtered by using 0.45-μm syringe filters (EMD Millipore) to obtain cell-free virus stocks. SHIV-E1p1, SHIV-E1p2, and SHIV-E1p5 are biological isolates from animals R547 (day 203), R551 (day 14), and R974 (day 42), respectively. Large stocks of SHIV-E1p5 were developed by coculturing SHIV-E1p5-infected PBMC from animal R974 and PBMC from prescreened naive RMs, as described above. A separate stock of SHIV-E1p5 was grown in human PBMC isolated from naive healthy donors for in vitro studies, including determining the sensitivity of SHIV-E1p5 to a panel of broadly neutralizing Abs (bnAbs) and broadly neutralizing human sera.

RNA isolation and deep sequencing.

Virus preparations isolated by PBMC coculture from passage 1, passage 2 (day 14), and passage 5 as well as citrate plasma samples from passage 2 (day 57) were selected for deep sequencing. Virus stocks or plasma was thawed, transferred to ultracentrifuge tubes on top of a 2-ml 20% sucrose cushion, and centrifuged (SW 28 rotor; Beckman Coulter) (4 h at 24,000 rpm at 4°C). The supernatant was removed, each sample was resuspended in 1 ml phosphate-buffered saline (PBS), and vRNA was purified from the samples by using the QIAamp viral RNA minikit (Qiagen). Contaminating DNA was digested with the RNase-free DNase set (Qiagen). RNA samples were prepared for sequencing as previously described (66). Briefly, DNA, rRNA, and mRNA were removed from harvested nucleic acids by using a Turbo DNA-free kit (Life Technologies), a Ribo-Zero magnetic gold kit (Epicenter Biotechnologies), and RNA purification beads (Illumina), respectively. The remaining material was cleaned and concentrated by using an RNA Clean and Concentrator-5 kit (Zymo). Sequencing libraries were generated by using the Illumina TruSeq total RNA sample preparation kit, according to the manufacturer's instructions. The library was then sequenced by applying sequencing by synthesis (Illumina) using the 150-bp paired-end format on an Illumina MiSeq system. Initial data analysis occurred by using the Illumina pipeline to generate a FASTQ file containing all the reads. This was then mapped to the parental virus sequence by using Lasergene Seq-Man NGen. Quality trimming to mers was performed on reads with a minimum similarity of 93%. Single nucleotide polymorphisms (SNPs) were quantified by determining the number of reads at each position and comparing the variability to the reference sequence. This permits the expression of SNP abundance as a percentage of total reads.

SHIV-E1 molecular phylogenetic analysis.

Env amino acid sequences of the SHIV-E1 parental IMC, SHIV-E1p1d203, SHIV-E1p2d14, SHIV-E1p2d57, and SHIV-E1p5 were aligned in Mega7. The evolutionary history was inferred by using the maximum likelihood method based on the JTT matrix-based model (67). The tree with the highest log likelihood (−2,904.91) is shown. The initial tree(s) for the heuristic search was obtained automatically by applying neighbor-joining and BioNJ algorithms to a matrix of pairwise distances estimated by using a JTT model and then selecting the topology with the superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site (next to the branches). The analysis involved 5 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 874 positions in the final data set. Evolutionary analyses were conducted in Mega7 (68).

Accession number(s).

The sequences determined in this study are available in GenBank, as follows: SHIV-E1p1d203 is under accession no. MH169603, SHIV-E1p2d14 is under accession no. MH169604, SHIV-E1p2d57 is under accession no. MH169605, and SHIV-E1p5 is under accession no. MH169606.

Go to:

ACKNOWLEDGMENTS

We thank Charla Andrews for support and discussions and Nancy Miller for support through a contract of the SVEU (HHSN272201100023C). We thank Barbara Felber for the gift of CEMx174-GFP cells, Joey Wang and Tho Hua for technical support, and Asha Nabbale and Juan Esquivel for their expert assistance in the preparation of the manuscript. TZM-bl cells were obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH, from John C. Kappes, Xiaoyun Wu, and Tranzyme Inc.

This work was supported by the Henry M. Jackson Foundation for the Advancement of Military Medicine Inc. (prime award no. W81XWH-11-2-0174, subaward no. 798196, to R.M.R.) and by R01 AI100703 to R.M.R. Neutralization tier phenotyping was supported by NIH/NIAID contract HHSN27201100016C (to D.C.M.). We thank the Yerkes National Primate Research Center Comparative AIDS Core (funded in part by ORIP/OD P51OD011132) for providing naive RM blood.

Go to:

REFERENCES

1. Rerks-Ngarm S, Pitisuttithum P, Nitayaphan S, Kaewkungwal J, Chiu J, Paris R, Premsri N, Namwat C, de Souza M, Adams E, Benenson M, Gurunathan S, Tartaglia J, McNeil JG, Francis DP, Stablein D, Birx DL, Chunsuttiwat S, Khamboonruang C, Thongcharoen P, Robb ML, Michael NL, Kunasol P, Kim JH. 2009. Vaccination with ALVAC and AIDSVAX to prevent HIV-1 infection in Thailand. N Engl J Med 361:2209–2220. doi:10.1056/NEJMoa0908492. [PubMed] [CrossRef] [Google Scholar]
2. Haynes BF, Gilbert PB, McElrath MJ, Zolla-Pazner S, Tomaras GD, Alam SM, Evans DT, Montefiori DC, Karnasuta C, Sutthent R, Liao HX, DeVico AL, Lewis GK, Williams C, Pinter A, Fong Y, Janes H, DeCamp A, Huang Y, Rao M, Billings E, Karasavvas N, Robb ML, Ngauy V, de Souza MS, Paris R, Ferrari G, Bailer RT, Soderberg KA, Andrews C, Berman PW, Frahm N, De Rosa SC, Alpert MD, Yates NL, Shen X, Koup RA, Pitisuttithum P, Kaewkungwal J, Nitayaphan S, Rerks-Ngarm S, Michael NL, Kim JH. 2012. Immune-correlates analysis of an HIV-1 vaccine efficacy trial. N Engl J Med 366:1275–1286. doi:10.1056/NEJMoa1113425. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
3. Bonsignori M, Pollara J, Moody MA, Alpert MD, Chen X, Hwang KK, Gilbert PB, Huang Y, Gurley TC, Kozink DM, Marshall DJ, Whitesides JF, Tsao CY, Kaewkungwal J, Nitayaphan S, Pitisuttithum P, Rerks-Ngarm S, Kim JH, Michael NL, Tomaras GD, Montefiori DC, Lewis GK, DeVico A, Evans DT, Ferrari G, Liao HX, Haynes BF. 2012. Antibody-dependent cellular cytotoxicity-mediating antibodies from an HIV-1 vaccine efficacy trial target multiple epitopes and preferentially use the VH1 gene family. J Virol 86:11521–11532. doi:10.1128/JVI.01023-12. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
4. Chung AW, Ghebremichael M, Robinson H, Brown E, Choi I, Lane S, Dugast AS, Schoen MK, Rolland M, Suscovich TJ, Mahan AE, Liao L, Streeck H, Andrews C, Rerks-Ngarm S, Nitayaphan S, de Souza MS, Kaewkungwal J, Pitisuttithum P, Francis D, Michael NL, Kim JH, Bailey-Kellogg C, Ackerman ME, Alter G. 2014. Polyfunctional Fc-effector profiles mediated by IgG subclass selection distinguish RV144 and VAX003 vaccines. Sci Transl Med 6:228ra38. doi:10.1126/scitranslmed.3007736. [PubMed] [CrossRef] [Google Scholar]
5. Chung AW, Kumar MP, Arnold KB, Yu WH, Schoen MK, Dunphy LJ, Suscovich TJ, Frahm N, Linde C, Mahan AE, Hoffner M, Streeck H, Ackerman ME, McElrath MJ, Schuitemaker H, Pau MG, Baden LR, Kim JH, Michael NL, Barouch DH, Lauffenburger DA, Alter G. 2015. Dissecting polyclonal vaccine-induced humoral immunity against HIV using systems serology. Cell 163:988–998. doi:10.1016/j.cell.2015.10.027. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
6. Corey L, Gilbert PB, Tomaras GD, Haynes BF, Pantaleo G, Fauci AS. 2015. Immune correlates of vaccine protection against HIV-1 acquisition. Sci Transl Med 7:310rv7. doi:10.1126/scitranslmed.aac7732. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
7. Pegu P, Vaccari M, Gordon S, Keele BF, Doster M, Guan Y, Ferrari G, Pal R, Ferrari MG, Whitney S, Hudacik L, Billings E, Rao M, Montefiori D, Tomaras G, Alam SM, Fenizia C, Lifson JD, Stablein D, Tartaglia J, Michael N, Kim J, Venzon D, Franchini G. 2013. Antibodies with high avidity to the gp120 envelope protein in protection from simian immunodeficiency virus SIV(mac251) acquisition in an immunization regimen that mimics the RV-144 Thai trial. J Virol 87:1708–1719. doi:10.1128/JVI.02544-12. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
8. Gordon SN, Liyanage NP, Doster MN, Vaccari M, Vargas-Inchaustegui DA, Pegu P, Schifanella L, Shen X, Tomaras GD, Rao M, Billings EA, Schwartz J, Prado I, Bobb K, Zhang W, Montefiori DC, Foulds KE, Ferrari G, Robert-Guroff M, Roederer M, Phan TB, Forthal DN, Stablein DM, Phogat S, Venzon DJ, Fouts T, Franchini G. 2016. Boosting of ALVAC-SIV vaccine-primed macaques with the CD4-SIVgp120 fusion protein elicits antibodies to V2 associated with a decreased risk of SIVmac251 acquisition. J Immunol 197:2726–2737. doi:10.4049/jimmunol.1600674. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
9. Li H, Wang S, Kong R, Ding W, Lee FH, Parker Z, Kim E, Learn GH, Hahn P, Policicchio B, Brocca-Cofano E, Deleage C, Hao X, Chuang GY, Gorman J, Gardner M, Lewis MG, Hatziioannou T, Santra S, Apetrei C, Pandrea I, Alam SM, Liao HX, Shen X, Tomaras GD, Farzan M, Chertova E, Keele BF, Estes JD, Lifson JD, Doms RW, Montefiori DC, Haynes BF, Sodroski JG, Kwong PD, Hahn BH, Shaw GM. 2016. Envelope residue 375 substitutions in simian-human immunodeficiency viruses enhance CD4 binding and replication in rhesus macaques. Proc Natl Acad Sci U S A 113:E3413–E3422. doi:10.1073/pnas.1606636113. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
10. Song RJ, Chenine AL, Rasmussen RA, Ruprecht CR, Mirshahidi S, Grisson RD, Xu W, Whitney JB, Goins LM, Ong H, Li PL, Shai-Kobiler E, Wang T, McCann CM, Zhang H, Wood C, Kankasa C, Secor WE, McClure HM, Strobert E, Else JG, Ruprecht RM. 2006. Molecularly cloned SHIV-1157ipd3N4: a highly replication-competent, mucosally transmissible R5 simian-human immunodeficiency virus encoding HIV clade C Env. J Virol 80:8729–8738. doi:10.1128/JVI.00558-06. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
11. Montano MA, Novitsky VA, Blackard JT, Cho NL, Katzenstein DA, Essex M. 1997. Divergent transcriptional regulation among expanding human immunodeficiency virus type 1 subtypes. J Virol 71:8657–8665. [PMC free article] [PubMed] [Google Scholar]
12. McCutchan FE, Hegerich PA, Brennan TP, Phanuphak P, Singharaj P, Jugsudee A, Berman PW, Gray AM, Fowler AK, Burke DS. 1992. Genetic variants of HIV-1 in Thailand. AIDS Res Hum Retroviruses 8:1887–1895. doi:10.1089/aid.1992.8.1887. [PubMed] [CrossRef] [Google Scholar]
13. Vaidian AK, Weiss LM, Tanowitz HB. 2004. Chagas' disease and AIDS. Kinetoplastid Biol Dis 3:2. doi:10.1186/1475-9292-3-2. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
14. Reimann KA, Li JT, Veazey R, Halloran M, Park IW, Karlsson GB, Sodroski J, Letvin NL. 1996. A chimeric simian/human immunodeficiency virus expressing a primary patient human immunodeficiency virus type 1 isolate env causes an AIDS-like disease after in vivo passage in rhesus monkeys. J Virol 70:6922–6928. [PMC free article] [PubMed] [Google Scholar]
15. Reimann KA, Li JT, Voss G, Lekutis C, Tenner-Racz K, Racz P, Lin W, Montefiori DC, Lee-Parritz DE, Lu Y, Collman RG, Sodroski J, Letvin NL. 1996. An env gene derived from a primary human immunodeficiency virus type 1 isolate confers high in vivo replicative capacity to a chimeric simian/human immunodeficiency virus in rhesus monkeys. J Virol 70:3198–3206. [PMC free article] [PubMed] [Google Scholar]
16. Edmonds TG, Ding H, Yuan X, Wei Q, Smith KS, Conway JA, Wieczorek L, Brown B, Polonis V, West JT, Montefiori DC, Kappes JC, Ochsenbauer C. 2010. Replication competent molecular clones of HIV-1 expressing Renilla luciferase facilitate the analysis of antibody inhibition in PBMC. Virology 408:1–13. doi:10.1016/j.virol.2010.08.028. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
17. Siddappa NB, Watkins JD, Wassermann KJ, Song R, Wang W, Kramer VG, Lakhashe S, Santosuosso M, Poznansky MC, Novembre FJ, Villinger F, Else JG, Montefiori DC, Rasmussen RA, Ruprecht RM. 2010. R5 clade C SHIV strains with tier 1 or 2 neutralization sensitivity: tools to dissect env evolution and to develop AIDS vaccines in primate models. PLoS One 5:e11689. doi:10.1371/journal.pone.0011689. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
18. Montefiori DC, Karnasuta C, Huang Y, Ahmed H, Gilbert P, de Souza MS, McLinden R, Tovanabutra S, Laurence-Chenine A, Sanders-Buell E, Moody MA, Bonsignori M, Ochsenbauer C, Kappes J, Tang H, Greene K, Gao H, LaBranche CC, Andrews C, Polonis VR, Rerks-Ngarm S, Pitisuttithum P, Nitayaphan S, Kaewkungwal J, Self SG, Berman PW, Francis D, Sinangil F, Lee C, Tartaglia J, Robb ML, Haynes BF, Michael NL, Kim JH. 2012. Magnitude and breadth of the neutralizing antibody response in the RV144 and Vax003 HIV-1 vaccine efficacy trials. J Infect Dis 206:431–441. doi:10.1093/infdis/jis367. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
19. Shang H, Han X, Shi X, Zuo T, Goldin M, Chen D, Han B, Sun W, Wu H, Wang X, Zhang L. 2011. Genetic and neutralization sensitivity of diverse HIV-1 env clones from chronically infected patients in China. J Biol Chem 286:14531–14541. doi:10.1074/jbc.M111.224527. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
20. Jakobsen MR, Cashin K, Roche M, Sterjovski J, Ellett A, Borm K, Flynn J, Erikstrup C, Gouillou M, Gray LR, Saksena NK, Wang B, Purcell DF, Kallestrup P, Zinyama-Gutsire R, Gomo E, Ullum H, Ostergaard L, Lee B, Ramsland PA, Churchill MJ, Gorry PR. 2013. Longitudinal analysis of CCR5 and CXCR4 usage in a cohort of antiretroviral therapy-naive subjects with progressive HIV-1 subtype C infection. PLoS One 8:e65950. doi:10.1371/journal.pone.0065950. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
21. Cashin K, Gray LR, Harvey KL, Perez-Bercoff D, Lee GQ, Sterjovski J, Roche M, Demarest JF, Drummond F, Harrigan PR, Churchill MJ, Gorry PR. 2015. Reliable genotypic tropism tests for the major HIV-1 subtypes. Sci Rep 5:8543. doi:10.1038/srep08543. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
22. Cashin K, Gray LR, Jakobsen MR, Sterjovski J, Churchill MJ, Gorry PR. 2013. CoRSeqV3-C: a novel HIV-1 subtype C specific V3 sequence based coreceptor usage prediction algorithm. Retrovirology 10:24. doi:10.1186/1742-4690-10-24. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
23. Zolla-Pazner S. 2004. Identifying epitopes of HIV-1 that induce protective antibodies. Nat Rev Immunol 4:199–210. doi:10.1038/nri1307. [PubMed] [CrossRef] [Google Scholar]
24. Xiang SH, Doka N, Choudhary RK, Sodroski J, Robinson JE. 2002. Characterization of CD4-induced epitopes on the HIV type 1 gp120 envelope glycoprotein recognized by neutralizing human monoclonal antibodies. AIDS Res Hum Retroviruses 18:1207–1217. doi:10.1089/08892220260387959. [PubMed] [CrossRef] [Google Scholar]
25. Chang HW, Tartaglia LJ, Whitney JB, Lim SY, Sanisetty S, Lavine CL, Seaman MS, Rademeyer C, Williamson C, Ellingson-Strouss K, Stamatatos L, Kublin J, Barouch DH. 2015. Generation and evaluation of clade C simian-human immunodeficiency virus challenge stocks. J Virol 89:1965–1974. doi:10.1128/JVI.03279-14. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
26. Tartaglia LJ, Chang HW, Lee BC, Abbink P, Ng'ang'a D, Boyd M, Lavine CL, Lim SY, Sanisetty S, Whitney JB, Seaman MS, Rolland M, Tovanabutra S, Ananworanich J, Robb ML, Kim JH, Michael NL, Barouch DH. 2016. Production of mucosally transmissible SHIV challenge stocks from HIV-1 circulating recombinant form 01_AE env sequences. PLoS Pathog 12:e1005431. doi:10.1371/journal.ppat.1005431. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
27. Liska V, Khimani AH, Hofmann-Lehmann R, Fink AN, Vlasak J, Ruprecht RM. 1999. Viremia and AIDS in rhesus macaques after intramuscular inoculation of plasmid DNA encoding full-length SIVmac239. AIDS Res Hum Retroviruses 15:445–450. doi:10.1089/088922299311196. [PubMed] [CrossRef] [Google Scholar]
28. Ilyinskii PO, Simon MA, Czajak SC, Lackner AA, Desrosiers RC. 1997. Induction of AIDS by simian immunodeficiency virus lacking NF-kappaB and SP1 binding elements. J Virol 71:1880–1887. [PMC free article] [PubMed] [Google Scholar]
29. Kent SJ, Dale CJ, Preiss S, Mills J, Campagna D, Purcell DF. 2001. Vaccination with attenuated simian immunodeficiency virus by DNA inoculation. J Virol 75:11930–11934. doi:10.1128/JVI.75.23.11930-11934.2001. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
30. Buckley KA, Li PL, Khimani AH, Hofmann-Lehmann R, Liska V, Anderson DC, McClure HM, Ruprecht RM. 2003. Convergent evolution of SIV env after independent inoculation of rhesus macaques with infectious proviral DNA. Virology 312:470–480. doi:10.1016/S0042-6822(03)00262-9. [PubMed] [CrossRef] [Google Scholar]
31. Kjos SA, Snowden KF, Olson JK. 2009. Biogeography and Trypanosoma cruzi infection prevalence of Chagas disease vectors in Texas, USA. Vector Borne Zoonotic Dis 9:41–50. doi:10.1089/vbz.2008.0026. [PubMed] [CrossRef] [Google Scholar]
32. Zabalgoitia M, Ventura J, Anderson L, Carey KD, Williams JT, Vandeberg JL. 2003. Morphologic and functional characterization of Chagasic heart disease in non-human primates. Am J Trop Med Hyg 68:248–252. [PubMed] [Google Scholar]
33. Zabalgoitia M, Ventura J, Anderson L, Williams JT, Carey KD, Vandeberg JL. 2003. Electrocardiographic findings in naturally acquired chagasic heart disease in nonhuman primates. J Electrocardiol 36:155–160. doi:10.1054/jelc.2003.50019. [PubMed] [CrossRef] [Google Scholar]
34. da Costa SC. 2000. Immunocompromised host: from the early events until the impact of acquired immunodeficiency syndrome. Mem Inst Oswaldo Cruz 95(Suppl 1):S141–S144. doi:10.1590/S0074-02762000000700023. [PubMed] [CrossRef] [Google Scholar]
35. Michailowsky V, Silva NM, Rocha CD, Vieira LQ, Lannes-Vieira J, Gazzinelli RT. 2001. Pivotal role of interleukin-12 and interferon-gamma axis in controlling tissue parasitism and inflammation in the heart and central nervous system during Trypanosoma cruzi infection. Am J Pathol 159:1723–1733. doi:10.1016/S0002-9440(10)63019-2. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
36. Harms G, Feldmeier H. 2002. HIV infection and tropical parasitic diseases—deleterious interactions in both directions? Trop Med Int Health 7:479–488. doi:10.1046/j.1365-3156.2002.00893.x. [PubMed] [CrossRef] [Google Scholar]
37. Stauffert D, Silveira MF, Mesenburg MA, Manta AB, Dutra AD, Bicca GL, Villela MM. 2017. Prevalence of Trypanosoma cruzi/HIV coinfection in southern Brazil. Braz J Infect Dis 21:180–184. doi:10.1016/j.bjid.2016.10.006. [PubMed] [CrossRef] [Google Scholar]
38. Chenine AL, Shai-Kobiler E, Steele LN, Ong H, Augostini P, Song R, Lee SJ, Autissier P, Ruprecht RM, Secor WE. 2008. Acute Schistosoma mansoni infection increases susceptibility to systemic SHIV clade C infection in rhesus macaques after mucosal virus exposure. PLoS Negl Trop Dis 2:e265. doi:10.1371/journal.pntd.0000265. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
39. Ayash-Rashkovsky M, Chenine AL, Steele LN, Lee SJ, Song R, Ong H, Rasmussen RA, Hofmann-Lehmann R, Else JG, Augostini P, McClure HM, Secor WE, Ruprecht RM. 2007. Coinfection with Schistosoma mansoni reactivates viremia in rhesus macaques with chronic simian-human immunodeficiency virus clade C infection. Infect Immun 75:1751–1756. doi:10.1128/IAI.01703-06. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
40. Cheng-Mayer C, Tasca S, Ho SH. 2009. Coreceptor switch in infection of nonhuman primates. Curr HIV Res 7:30–38. doi:10.2174/157016209787048500. [PubMed] [CrossRef] [Google Scholar]
41. Ho SH, Tasca S, Shek L, Li A, Gettie A, Blanchard J, Boden D, Cheng-Mayer C. 2007. Coreceptor switch in R5-tropic simian/human immunodeficiency virus-infected macaques. J Virol 81:8621–8633. doi:10.1128/JVI.00759-07. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
42. Ho SH, Trunova N, Gettie A, Blanchard J, Cheng-Mayer C. 2008. Different mutational pathways to CXCR4 coreceptor switch of CCR5-using simian-human immunodeficiency virus. J Virol 82:5653–5656. doi:10.1128/JVI.00145-08. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
43. Tasca S, Ho SH, Cheng-Mayer C. 2008. R5X4 viruses are evolutionary, functional, and antigenic intermediates in the pathway of a simian-human immunodeficiency virus coreceptor switch. J Virol 82:7089–7099. doi:10.1128/JVI.00570-08. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
44. Rizzuto C, Sodroski J. 2000. Fine definition of a conserved CCR5-binding region on the human immunodeficiency virus type 1 glycoprotein 120. AIDS Res Hum Retroviruses 16:741–749. doi:10.1089/088922200308747. [PubMed] [CrossRef] [Google Scholar]
45. Biscone MJ, Miamidian JL, Muchiri JM, Baik SS, Lee FH, Doms RW, Reeves JD. 2006. Functional impact of HIV coreceptor-binding site mutations. Virology 351:226–236. doi:10.1016/j.virol.2006.03.017. [PubMed] [CrossRef] [Google Scholar]
46. Raymond S, Delobel P, Rogez S, Encinas S, Bruel P, Pasquier C, Sandres-Saune K, Marchou B, Massip P, Izopet J. 2013. Genotypic prediction of HIV-1 CRF01-AE tropism. J Clin Microbiol 51:564–570. doi:10.1128/JCM.02328-12. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
47. Allen TM, Vogel TU, Fuller DH, Mothe BR, Steffen S, Boyson JE, Shipley T, Fuller J, Hanke T, Sette A, Altman JD, Moss B, McMichael AJ, Watkins DI. 2000. Induction of AIDS virus-specific CTL activity in fresh, unstimulated peripheral blood lymphocytes from rhesus macaques vaccinated with a DNA prime/modified vaccinia virus Ankara boost regimen. J Immunol 164:4968–4978. doi:10.4049/jimmunol.164.9.4968. [PubMed] [CrossRef] [Google Scholar]
48. Uberla K, Stahl-Hennig C, Bottiger D, Matz-Rensing K, Kaup FJ, Li J, Haseltine WA, Fleckenstein B, Hunsmann G, Oberg B. 1995. Animal model for the therapy of acquired immunodeficiency syndrome with reverse transcriptase inhibitors. Proc Natl Acad Sci U S A 92:8210–8214. [PMC free article] [PubMed] [Google Scholar]
49. Goldstein S, Elkins WR, London WT, Hahn A, Goeken R, Martin JE, Hirsch VM. 1994. Immunization with whole inactivated vaccine protects from infection by SIV grown in human but not macaque cells. J Med Primatol 23:75–82. doi:10.1111/j.1600-0684.1994.tb00105.x. [PubMed] [CrossRef] [Google Scholar]
50. Putkonen P, Thorstensson R, Cranage M, Nilsson C, Ghavamzadeh L, Albert J, Greenaway P, Biberfeld G. 1992. A formalin inactivated whole SIVmac vaccine in Ribi adjuvant protects against homologous and heterologous SIV challenge. J Med Primatol 21:108–112. [PubMed] [Google Scholar]
51. Montano MA, Nixon CP, Ndung'u T, Bussmann H, Novitsky VA, Dickman D, Essex M. 2000. Elevated tumor necrosis factor-alpha activation of human immunodeficiency virus type 1 subtype C in southern Africa is associated with an NF-kappaB enhancer gain-of-function. J Infect Dis 181:76–81. doi:10.1086/315185. [PubMed] [CrossRef] [Google Scholar]
52. Sullivan PS, Do AN, Ellenberger D, Pau CP, Paul S, Robbins K, Kalish M, Storck C, Schable CA, Wise H, Tetteh C, Jones JL, McFarland J, Yang C, Lal RB, Ward JW. 2000. Human immunodeficiency virus (HIV) subtype surveillance of African-born persons at risk for group O and group N HIV infections in the United States. J Infect Dis 181:463–469. doi:10.1086/315254. [PubMed] [CrossRef] [Google Scholar]
53. Grisson RD, Chenine AL, Yeh LY, He J, Wood C, Bhat GJ, Xu W, Kankasa C, Ruprecht RM. 2004. Infectious molecular clone of a recently transmitted pediatric human immunodeficiency virus clade C isolate from Africa: evidence of intraclade recombination. J Virol 78:14066–14069. doi:10.1128/JVI.78.24.14066-14069.2004. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
54. Platt EJ, Wehrly K, Kuhmann SE, Chesebro B, Kabat D. 1998. Effects of CCR5 and CD4 cell surface concentrations on infections by macrophagetropic isolates of human immunodeficiency virus type 1. J Virol 72:2855–2864. [PMC free article] [PubMed] [Google Scholar]
55. Derdeyn CA, Decker JM, Sfakianos JN, Wu X, O'Brien WA, Ratner L, Kappes JC, Shaw GM, Hunter E. 2000. Sensitivity of human immunodeficiency virus type 1 to the fusion inhibitor T-20 is modulated by coreceptor specificity defined by the V3 loop of gp120. J Virol 74:8358–8367. doi:10.1128/JVI.74.18.8358-8367.2000. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
56. Wei X, Decker JM, Liu H, Zhang Z, Arani RB, Kilby JM, Saag MS, Wu X, Shaw GM, Kappes JC. 2002. Emergence of resistant human immunodeficiency virus type 1 in patients receiving fusion inhibitor (T-20) monotherapy. Antimicrob Agents Chemother 46:1896–1905. doi:10.1128/AAC.46.6.1896-1905.2002. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
57. Takeuchi Y, McClure MO, Pizzato M. 2008. Identification of gammaretroviruses constitutively released from cell lines used for human immunodeficiency virus research. J Virol 82:12585–12588. doi:10.1128/JVI.01726-08. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
58. Platt EJ, Bilska M, Kozak SL, Kabat D, Montefiori DC. 2009. Evidence that ecotropic murine leukemia virus contamination in TZM-bl cells does not affect the outcome of neutralizing antibody assays with human immunodeficiency virus type 1. J Virol 83:8289–8292. doi:10.1128/JVI.00709-09. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
59. Montefiori DC. 2009. Measuring HIV neutralization in a luciferase reporter gene assay. Methods Mol Biol 485:395–405. doi:10.1007/978-1-59745-170-3_26. [PubMed] [CrossRef] [Google Scholar]
60. Li M, Gao F, Mascola JR, Stamatatos L, Polonis VR, Koutsoukos M, Voss G, Goepfert P, Gilbert P, Greene KM, Bilska M, Kothe DL, Salazar-Gonzalez JF, Wei X, Decker JM, Hahn BH, Montefiori DC. 2005. Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standardized assessments of vaccine-elicited neutralizing antibodies. J Virol 79:10108–10125. doi:10.1128/JVI.79.16.10108-10125.2005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
61. Seaman MS, Janes H, Hawkins N, Grandpre LE, Devoy C, Giri A, Coffey RT, Harris L, Wood B, Daniels MG, Bhattacharya T, Lapedes A, Polonis VR, McCutchan FE, Gilbert PB, Self SG, Korber BT, Montefiori DC, Mascola JR. 2010. Tiered categorization of a diverse panel of HIV-1 Env pseudoviruses for assessment of neutralizing antibodies. J Virol 84:1439–1452. doi:10.1128/JVI.02108-09. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
62. National Research Council. 2011. Guide for the care and use of laboratory animals, 8th ed National Academies Press, Washington, DC. [Google Scholar]
63. National Institutes of Health. 2002. Public Health Service policy on humane care and use of laboratory animals. Office of Laboratory Animal Welfare, National Institutes of Health, Bethesda, MD. [Google Scholar]
64. Romano JW, Shurtliff RN, Dobratz E, Gibson A, Hickman K, Markham PD, Pal R. 2000. Quantitative evaluation of simian immunodeficiency virus infection using NASBA technology. J Virol Methods 86:61–70. doi:10.1016/S0166-0934(99)00184-6. [PubMed] [CrossRef] [Google Scholar]
65. Lee EM, Chung HK, Livesay J, Suschak J, Finke L, Hudacik L, Galmin L, Bowen B, Markham P, Cristillo A, Pal R. 2010. Molecular methods for evaluation of virological status of nonhuman primates challenged with simian immunodeficiency or simian-human immunodeficiency viruses. J Virol Methods 163:287–294. doi:10.1016/j.jviromet.2009.10.012. [PubMed] [CrossRef] [Google Scholar]
66. Alfson KJ, Avena LE, Beadles MW, Menzie H, Patterson JL, Carrion R Jr, Griffiths A. 2015. Genetic changes at the glycoprotein editing site associated with serial passage of Sudan virus. J Infect Dis 212(Suppl 2):S295–S304. doi:10.1093/infdis/jiv216. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
67. Jones DT, Taylor WR, Thornton JM. 1992. The rapid generation of mutation data matrices from protein sequences. Comput Appl Biosci 8:275–282. [PubMed] [Google Scholar]
68. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870–1874. doi:10.1093/molbev/msw054. [PubMed] [CrossRef] [Google Scholar]
69. Autissier P, Soulas C, Burdo TH, Williams KC. 2010. Immunophenotyping of lymphocyte, monocyte and dendritic cell subsets in normal rhesus macaques by 12-color flow cytometry: clarification on DC heterogeneity. J Immunol Methods 360:119–128. doi:10.1016/j.jim.2010.06.017. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
70. Utachee P, Jinnopat P, Isarangkura-Na-Ayuthaya P, de Silva UC, Nakamura S, Siripanyaphinyo U, Wichukchinda N, Tokunaga K, Yasunaga T, Sawanpanyalert P, Ikuta K, Auwanit W, Kameoka M. 2009. Genotypic characterization of CRF01_AE env genes derived from human immunodeficiency virus type 1-infected patients residing in central Thailand. AIDS Res Hum Retroviruses 25:229–236. doi:10.1089/aid.2008.0232. [PubMed] [CrossRef] [Google Scholar]